Mutagenetix > Incidental Mutations

Incidental Mutation 'R5135:Large1'

396134

Institutional Source

Beutler Lab

Gene Symbol

Large1

Ensembl Gene

ENSMUSG00000004383

Gene Name

LARGE xylosyl- and glucuronyltransferase 1

Synonyms

froggy, BPFD#36, fg, enr

MMRRC Submission

043261-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.453) question?

Stock #

R5135 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

72814599-73353540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 72818096 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 685 (I685L)

Ref Sequence

ENSEMBL: ENSMUSP00000148336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004497] [ENSMUST00000119826] [ENSMUST00000212459]

AlphaFold

Q9Z1M7

Predicted Effect

probably benign
Transcript: ENSMUST00000004497
AA Change: I685L

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000004497
Gene: ENSMUSG00000004383
AA Change: I685L

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
coiled coil region	55	90	N/A	INTRINSIC
Pfam:Glyco_transf_8	141	387	6.2e-22	PFAM
Pfam:Glyco_transf_49	473	540	5.2e-15	PFAM
Pfam:Glyco_transf_49	535	743	1.1e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000119826
AA Change: I685L

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000112617
Gene: ENSMUSG00000004383
AA Change: I685L

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
coiled coil region	55	90	N/A	INTRINSIC
Pfam:Glyco_transf_8	142	386	3e-23	PFAM
Pfam:Glyco_transf_49	473	540	2.3e-11	PFAM
Pfam:Glyco_transf_49	520	743	2.7e-44	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000212459
AA Change: I685L

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)

Meta Mutation Damage Score

0.0921

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.1%

Validation Efficiency

98% (82/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes exhibit a progressive myopathy, abnormal posture, thoracic kyphosis, calcium deposits in muscle, loss of Schwann cells and myelin, eye and CNS defects, deafness, reduced growth, and death around 4 months. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700056E22Rik	T	C	1: 184,033,506	S119G	probably benign	Het
4930553M12Rik	G	T	4: 88,868,271	H37N	unknown	Het
Adam10	T	A	9: 70,766,074	C496S	probably damaging	Het
Akap2	G	T	4: 57,855,912	A414S	probably benign	Het
Aldh18a1	A	C	19: 40,554,817		probably benign	Het
Alox5	A	G	6: 116,413,786	F468S	probably benign	Het
Ankrd50	T	C	3: 38,455,803	H805R	probably damaging	Het
Ap2s1	T	A	7: 16,747,323	D72E	probably damaging	Het
Apaf1	T	C	10: 91,060,094	Y372C	probably damaging	Het
Apob	C	T	12: 8,010,086	T2823I	probably damaging	Het
Bhmt	A	G	13: 93,627,323	V70A	probably damaging	Het
Cdc42bpg	T	A	19: 6,320,618	L1247H	probably damaging	Het
Cel	A	G	2: 28,559,423	V264A	probably benign	Het
Celsr2	T	C	3: 108,398,659	N2043S	probably damaging	Het
Clca4a	A	T	3: 144,954,946	W706R	probably damaging	Het
Col22a1	G	T	15: 71,799,337	P1058Q	unknown	Het
Cyp4a14	A	G	4: 115,489,960		probably null	Het
Dhx30	T	G	9: 110,098,795	R55S	probably damaging	Het
Dlgap5	C	T	14: 47,399,665	R452H	probably damaging	Het
Dnah12	T	A	14: 26,770,477	D1191E	probably damaging	Het
Dock3	A	T	9: 106,932,997	I164N	probably damaging	Het
Edrf1	T	A	7: 133,651,044	M436K	probably benign	Het
Eif2ak2	T	A	17: 78,866,345	Y268F	probably damaging	Het
Evi2a	G	A	11: 79,527,451	T111M	possibly damaging	Het
Fzd4	A	G	7: 89,407,501	E252G	probably damaging	Het
Gcm2	A	G	13: 41,102,959	V438A	probably benign	Het
Gm10722	T	C	9: 3,000,937	C6R	probably benign	Het
Gm21994	A	T	2: 150,255,490	Y34*	probably null	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gm4846	T	C	1: 166,483,982	D436G	probably damaging	Het
Gm5414	T	A	15: 101,627,768	I141F	probably damaging	Het
Gm6185	T	A	1: 161,198,231		noncoding transcript	Het
Grip2	T	C	6: 91,773,916	E776G	possibly damaging	Het
H2-Ob	T	A	17: 34,243,516	V160E	probably benign	Het
Hormad1	T	C	3: 95,585,220		probably benign	Het
Ighv2-1	A	T	12: 113,574,462		probably benign	Het
Igkv4-92	A	T	6: 68,755,554	C14S	probably benign	Het
Iqsec3	T	C	6: 121,383,919	I993M	probably damaging	Het
Kdm5b	T	A	1: 134,588,746		probably benign	Het
Kitl	T	C	10: 100,088,222		probably null	Het
Klhl26	G	T	8: 70,452,718	R100S	probably benign	Het
Kpna4	C	T	3: 69,092,809		probably null	Het
Lama5	T	A	2: 180,202,220	N383Y	possibly damaging	Het
Larp4b	A	G	13: 9,170,737	E590G	probably damaging	Het
Liph	A	T	16: 21,956,165	C425*	probably null	Het
Lrrc31	A	T	3: 30,684,890	C327*	probably null	Het
Lrrc36	T	C	8: 105,463,898	V733A	probably benign	Het
Mmel1	T	A	4: 154,882,324	I83K	probably benign	Het
Myo16	G	T	8: 10,476,114	V885L	probably benign	Het
Naip2	A	T	13: 100,179,440	N277K	probably damaging	Het
Ncapg2	T	A	12: 116,427,786	I485N	possibly damaging	Het
Npc1l1	A	T	11: 6,224,245	Y687N	possibly damaging	Het
Obscn	A	T	11: 59,129,653	V922E	probably damaging	Het
Oc90	A	G	15: 65,883,830	S223P	probably benign	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1253	A	T	2: 89,751,895	L311H	possibly damaging	Het
Olfr1508	T	C	14: 52,463,854	I52V	probably benign	Het
Pdlim5	C	T	3: 142,304,365	R174H	probably benign	Het
Pex5l	G	T	3: 32,955,831	A386E	probably damaging	Het
Plcxd1	T	A	5: 110,101,363		probably benign	Het
Pramef8	T	G	4: 143,419,009	S349R	probably benign	Het
Prl8a1	A	T	13: 27,579,819		probably null	Het
Ryr2	G	T	13: 11,662,130	N3278K	probably benign	Het
Sacm1l	A	G	9: 123,577,025	M324V	probably benign	Het
Sdad1	T	C	5: 92,303,934	T143A	probably benign	Het
Sec11a	A	T	7: 80,923,064		probably benign	Het
Sema6a	A	G	18: 47,291,172	V223A	probably damaging	Het
Serpinb6c	A	G	13: 33,880,097	V325A	probably damaging	Het
Slc4a2	G	A	5: 24,430,127	A177T	possibly damaging	Het
Slc5a4a	A	G	10: 76,147,594	N22D	unknown	Het
Stard13	C	T	5: 151,062,767	W308*	probably null	Het
Tanc2	C	T	11: 105,857,553	L504F	possibly damaging	Het
Tfap2e	G	T	4: 126,720,544	N282K	probably damaging	Het
Uhrf1bp1l	T	C	10: 89,789,355	I48T	probably damaging	Het
Usp36	G	T	11: 118,264,905	T682K	possibly damaging	Het
Zc3h11a	T	C	1: 133,633,789	T315A	probably benign	Het
Zfa-ps	T	A	10: 52,543,022		noncoding transcript	Het
Zfp663	A	T	2: 165,353,670	C210S	possibly damaging	Het
Zfp747	T	C	7: 127,374,394	I201M	probably damaging	Het
Zic4	C	T	9: 91,384,152	T276M	probably damaging	Het

Other mutations in Large1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Large1	APN	8	72837497	missense	probably damaging	1.00
IGL00326:Large1	APN	8	73131983	missense	probably benign
IGL00418:Large1	APN	8	72823841	critical splice acceptor site	probably null
IGL01155:Large1	APN	8	73131989	missense	probably benign	0.01
IGL01793:Large1	APN	8	72859181	splice site	probably benign
IGL01929:Large1	APN	8	72859275	missense	probably damaging	1.00
IGL02218:Large1	APN	8	72912122	missense	probably damaging	1.00
IGL02276:Large1	APN	8	72818093	missense	probably benign	0.00
IGL02329:Large1	APN	8	73048317	missense	possibly damaging	0.80
IGL02543:Large1	APN	8	73048414	missense	probably benign	0.00
IGL02887:Large1	APN	8	73132039	missense	probably benign	0.07
biggs	UTSW	8	73116419	missense	probably damaging	1.00
umber	UTSW	8	72883264	nonsense	probably null
R0179:Large1	UTSW	8	73098846	missense	probably benign	0.09
R0477:Large1	UTSW	8	72818082	missense	probably damaging	1.00
R0587:Large1	UTSW	8	72859333	missense	probably damaging	1.00
R0791:Large1	UTSW	8	73048479	splice site	probably benign
R1253:Large1	UTSW	8	73048422	missense	probably damaging	0.98
R1695:Large1	UTSW	8	72818082	missense	probably damaging	1.00
R2017:Large1	UTSW	8	72852197	missense	probably damaging	1.00
R4835:Large1	UTSW	8	73048347	missense	probably damaging	1.00
R5105:Large1	UTSW	8	72852244	nonsense	probably null
R5120:Large1	UTSW	8	72859341	missense	probably damaging	1.00
R5137:Large1	UTSW	8	73048309	missense	possibly damaging	0.58
R5567:Large1	UTSW	8	72837453	missense	possibly damaging	0.93
R5945:Large1	UTSW	8	72852200	missense	probably damaging	0.99
R6619:Large1	UTSW	8	72883264	nonsense	probably null
R6951:Large1	UTSW	8	73116419	missense	probably damaging	1.00
R7041:Large1	UTSW	8	73116464	missense	probably damaging	0.98
R7300:Large1	UTSW	8	72837596	missense	probably damaging	1.00
R7493:Large1	UTSW	8	72823715	missense	probably benign	0.23
R7877:Large1	UTSW	8	73116443	missense	probably damaging	1.00
R8118:Large1	UTSW	8	73131944	missense	probably benign	0.40
R8129:Large1	UTSW	8	72815957	missense	probably damaging	1.00
R8525:Large1	UTSW	8	72837492	missense	probably damaging	1.00
R8963:Large1	UTSW	8	72815984	missense	probably damaging	1.00
R9170:Large1	UTSW	8	72816017	missense	probably benign	0.00
Z1088:Large1	UTSW	8	72912103	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTAACCCTGGCCAGAAACCTAG -3'
(R):5'- TATGGACTAAAGGCCATGCAC -3'

Sequencing Primer
(F):5'- TGGCCAGAAACCTAGTTCCTATG -3'
(R):5'- CCCACAAACTTTGCCAAGTGG -3'

Posted On

2016-06-21