Incidental Mutation 'R5135:Kitl'
ID 396145
Institutional Source Beutler Lab
Gene Symbol Kitl
Ensembl Gene ENSMUSG00000019966
Gene Name kit ligand
Synonyms Gb, grizzle-belly, Mgf, SCF, SF, Sl, SLF, Steel, Steel factor, stem cell factor
MMRRC Submission 043261-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock # R5135 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 100015630-100100416 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 100088222 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020129] [ENSMUST00000105283] [ENSMUST00000218200]
AlphaFold P20826
Predicted Effect probably null
Transcript: ENSMUST00000020129
SMART Domains Protein: ENSMUSP00000020129
Gene: ENSMUSG00000019966

DomainStartEndE-ValueType
Pfam:SCF 1 176 5.7e-102 PFAM
Pfam:SCF 173 245 1.7e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105283
SMART Domains Protein: ENSMUSP00000100920
Gene: ENSMUSG00000019966

DomainStartEndE-ValueType
Pfam:SCF 1 273 2.3e-157 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000218200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219881
Meta Mutation Damage Score 0.9483 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the ligand of the tyrosine-kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that acts in utero in germ cell and neural cell development, and hematopoiesis, all believed to reflect a role in cell migration. In adults, it functions pleiotropically, while mostly noted for its continued requirement in hematopoiesis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene affect migration of embryonic stem cells and cause similar phenotypes to mutations in its receptor gene (Kit). Mutants show mild to severe defects in pigmentation, hemopoiesis and reproduction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik T C 1: 184,033,506 S119G probably benign Het
4930553M12Rik G T 4: 88,868,271 H37N unknown Het
Adam10 T A 9: 70,766,074 C496S probably damaging Het
Akap2 G T 4: 57,855,912 A414S probably benign Het
Aldh18a1 A C 19: 40,554,817 probably benign Het
Alox5 A G 6: 116,413,786 F468S probably benign Het
Ankrd50 T C 3: 38,455,803 H805R probably damaging Het
Ap2s1 T A 7: 16,747,323 D72E probably damaging Het
Apaf1 T C 10: 91,060,094 Y372C probably damaging Het
Apob C T 12: 8,010,086 T2823I probably damaging Het
Bhmt A G 13: 93,627,323 V70A probably damaging Het
Cdc42bpg T A 19: 6,320,618 L1247H probably damaging Het
Cel A G 2: 28,559,423 V264A probably benign Het
Celsr2 T C 3: 108,398,659 N2043S probably damaging Het
Clca4a A T 3: 144,954,946 W706R probably damaging Het
Col22a1 G T 15: 71,799,337 P1058Q unknown Het
Cyp4a14 A G 4: 115,489,960 probably null Het
Dhx30 T G 9: 110,098,795 R55S probably damaging Het
Dlgap5 C T 14: 47,399,665 R452H probably damaging Het
Dnah12 T A 14: 26,770,477 D1191E probably damaging Het
Dock3 A T 9: 106,932,997 I164N probably damaging Het
Edrf1 T A 7: 133,651,044 M436K probably benign Het
Eif2ak2 T A 17: 78,866,345 Y268F probably damaging Het
Evi2a G A 11: 79,527,451 T111M possibly damaging Het
Fzd4 A G 7: 89,407,501 E252G probably damaging Het
Gcm2 A G 13: 41,102,959 V438A probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gm21994 A T 2: 150,255,490 Y34* probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm4846 T C 1: 166,483,982 D436G probably damaging Het
Gm5414 T A 15: 101,627,768 I141F probably damaging Het
Gm6185 T A 1: 161,198,231 noncoding transcript Het
Grip2 T C 6: 91,773,916 E776G possibly damaging Het
H2-Ob T A 17: 34,243,516 V160E probably benign Het
Hormad1 T C 3: 95,585,220 probably benign Het
Ighv2-1 A T 12: 113,574,462 probably benign Het
Igkv4-92 A T 6: 68,755,554 C14S probably benign Het
Iqsec3 T C 6: 121,383,919 I993M probably damaging Het
Kdm5b T A 1: 134,588,746 probably benign Het
Klhl26 G T 8: 70,452,718 R100S probably benign Het
Kpna4 C T 3: 69,092,809 probably null Het
Lama5 T A 2: 180,202,220 N383Y possibly damaging Het
Large1 T G 8: 72,818,096 I685L probably benign Het
Larp4b A G 13: 9,170,737 E590G probably damaging Het
Liph A T 16: 21,956,165 C425* probably null Het
Lrrc31 A T 3: 30,684,890 C327* probably null Het
Lrrc36 T C 8: 105,463,898 V733A probably benign Het
Mmel1 T A 4: 154,882,324 I83K probably benign Het
Myo16 G T 8: 10,476,114 V885L probably benign Het
Naip2 A T 13: 100,179,440 N277K probably damaging Het
Ncapg2 T A 12: 116,427,786 I485N possibly damaging Het
Npc1l1 A T 11: 6,224,245 Y687N possibly damaging Het
Obscn A T 11: 59,129,653 V922E probably damaging Het
Oc90 A G 15: 65,883,830 S223P probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1253 A T 2: 89,751,895 L311H possibly damaging Het
Olfr1508 T C 14: 52,463,854 I52V probably benign Het
Pdlim5 C T 3: 142,304,365 R174H probably benign Het
Pex5l G T 3: 32,955,831 A386E probably damaging Het
Plcxd1 T A 5: 110,101,363 probably benign Het
Pramef8 T G 4: 143,419,009 S349R probably benign Het
Prl8a1 A T 13: 27,579,819 probably null Het
Ryr2 G T 13: 11,662,130 N3278K probably benign Het
Sacm1l A G 9: 123,577,025 M324V probably benign Het
Sdad1 T C 5: 92,303,934 T143A probably benign Het
Sec11a A T 7: 80,923,064 probably benign Het
Sema6a A G 18: 47,291,172 V223A probably damaging Het
Serpinb6c A G 13: 33,880,097 V325A probably damaging Het
Slc4a2 G A 5: 24,430,127 A177T possibly damaging Het
Slc5a4a A G 10: 76,147,594 N22D unknown Het
Stard13 C T 5: 151,062,767 W308* probably null Het
Tanc2 C T 11: 105,857,553 L504F possibly damaging Het
Tfap2e G T 4: 126,720,544 N282K probably damaging Het
Uhrf1bp1l T C 10: 89,789,355 I48T probably damaging Het
Usp36 G T 11: 118,264,905 T682K possibly damaging Het
Zc3h11a T C 1: 133,633,789 T315A probably benign Het
Zfa-ps T A 10: 52,543,022 noncoding transcript Het
Zfp663 A T 2: 165,353,670 C210S possibly damaging Het
Zfp747 T C 7: 127,374,394 I201M probably damaging Het
Zic4 C T 9: 91,384,152 T276M probably damaging Het
Other mutations in Kitl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Kitl APN 10 100087344 splice site probably benign
IGL02066:Kitl APN 10 100076882 missense probably damaging 1.00
IGL03211:Kitl APN 10 100080859 missense probably benign 0.19
Gregory UTSW 10 100076906 critical splice donor site probably null
mooyah UTSW 10 100088222 critical splice donor site probably null
Sandycheeks UTSW 10 100076906 critical splice donor site probably null
R0131:Kitl UTSW 10 100087364 missense probably benign 0.11
R0131:Kitl UTSW 10 100087364 missense probably benign 0.11
R0132:Kitl UTSW 10 100087364 missense probably benign 0.11
R1554:Kitl UTSW 10 100087438 missense probably benign 0.38
R1649:Kitl UTSW 10 100064114 missense probably benign 0.03
R2194:Kitl UTSW 10 100016037 critical splice donor site probably null
R2254:Kitl UTSW 10 100080131 critical splice donor site probably null
R4877:Kitl UTSW 10 100080866 missense probably damaging 1.00
R5453:Kitl UTSW 10 100087385 missense probably damaging 1.00
R5564:Kitl UTSW 10 100080024 missense possibly damaging 0.89
R5832:Kitl UTSW 10 100080020 missense probably damaging 1.00
R5971:Kitl UTSW 10 100076906 critical splice donor site probably null
R6043:Kitl UTSW 10 100064085 missense probably damaging 1.00
R6067:Kitl UTSW 10 100076906 critical splice donor site probably null
R6138:Kitl UTSW 10 100076906 critical splice donor site probably null
R6255:Kitl UTSW 10 100089233 makesense probably null
R6450:Kitl UTSW 10 100087394 start codon destroyed probably null 0.00
R6588:Kitl UTSW 10 100064092 missense probably damaging 1.00
R6951:Kitl UTSW 10 100051852 missense probably damaging 1.00
R7315:Kitl UTSW 10 100016112 missense unknown
R7368:Kitl UTSW 10 100016081 missense probably benign 0.02
R8010:Kitl UTSW 10 100051903 missense probably benign 0.22
R8234:Kitl UTSW 10 100051846 missense probably damaging 1.00
U15987:Kitl UTSW 10 100076906 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCTAAAAGACAAGCACCGG -3'
(R):5'- AATGTGCCTTCCCAGACACTATTC -3'

Sequencing Primer
(F):5'- GTGACGGTGGCTCAGTTGC -3'
(R):5'- GCCTTCCCAGACACTATTCATAGG -3'
Posted On 2016-06-21