Mutagenetix > Incidental Mutations

Incidental Mutation 'R0450:Enpp3'

39615

Institutional Source

Beutler Lab

Gene Symbol

Enpp3

Ensembl Gene

ENSMUSG00000019989

Gene Name

ectonucleotide pyrophosphatase/phosphodiesterase 3

Synonyms

CD203c

MMRRC Submission

038650-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.142) question?

Stock #

R0450 (G1)

Quality Score

129

Status

Not validated

Chromosome

Chromosomal Location

24772406-24842823 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 24776781 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 759 (D759E)

Ref Sequence

ENSEMBL: ENSMUSP00000020169 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020169]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020169
AA Change: D759E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: D759E

Domain	Start	End	E-Value	Type
transmembrane domain	23	45	N/A	INTRINSIC
SO	50	93	1.99e-13	SMART
SO	94	137	7.66e-15	SMART
Pfam:Phosphodiest	161	485	1.7e-87	PFAM
Blast:Endonuclease_NS	543	599	9e-15	BLAST
Endonuclease_NS	626	847	5.41e-16	SMART
NUC	627	856	1.54e-92	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000218343

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219861

Meta Mutation Damage Score

0.2896

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acoxl	G	A	2: 127,880,503		probably null	Het
AI606181	A	C	19: 41,593,731	K113N	unknown	Het
Ankrd11	T	C	8: 122,892,175	D1646G	possibly damaging	Het
Ap2m1	T	A	16: 20,542,240	I334N	possibly damaging	Het
Arih2	T	A	9: 108,605,092	H490L	possibly damaging	Het
Cdhr1	T	C	14: 37,080,676	Y610C	probably damaging	Het
Cdkal1	C	A	13: 29,691,596		probably null	Het
Cep76	A	T	18: 67,634,780	N227K	probably benign	Het
Clca4b	A	T	3: 144,913,351	Y676N	probably damaging	Het
Cog2	T	C	8: 124,529,058		probably null	Het
Col6a4	A	T	9: 106,080,547	V26D	probably damaging	Het
Dcaf11	T	C	14: 55,569,080	V446A	probably damaging	Het
Dync1h1	C	A	12: 110,639,944	Q2483K	probably benign	Het
Etfbkmt	C	T	6: 149,150,584	R96W	probably benign	Het
Fam83a	C	A	15: 58,009,926	Q384K	probably benign	Het
Glipr1l2	A	G	10: 112,092,572	D124G	probably benign	Het
Gm8251	T	A	1: 44,061,097	K280N	possibly damaging	Het
Gucy2e	T	C	11: 69,235,576	D326G	probably benign	Het
Hnrnph3	T	A	10: 63,018,215	R41S	probably benign	Het
Hnrnph3	T	A	10: 63,019,500	D2V	probably damaging	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Itpr2	T	C	6: 146,417,979	T188A	possibly damaging	Het
Krt23	T	A	11: 99,486,782	I133L	probably damaging	Het
Krt74	T	C	15: 101,763,316		noncoding transcript	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Map1a	A	T	2: 121,305,774	H2357L	probably benign	Het
Mbl1	A	G	14: 41,158,749	N198S	probably damaging	Het
Mcf2l	A	G	8: 12,997,337	D233G	probably damaging	Het
Mdga2	T	C	12: 66,470,926	K45E	possibly damaging	Het
Mdn1	A	G	4: 32,738,619	N3524S	probably benign	Het
Mospd3	A	G	5: 137,597,032	L233P	probably damaging	Het
Msto1	A	G	3: 88,911,541	L269P	probably benign	Het
Olfr1138	A	G	2: 87,737,481	V281A	probably damaging	Het
Olfr1238	A	T	2: 89,406,791	M96K	probably damaging	Het
Olfr467	T	C	7: 107,814,688	Y35H	probably damaging	Het
Olfr870	T	C	9: 20,171,265	Y102C	probably benign	Het
Olfr944	G	A	9: 39,217,728	V124I	possibly damaging	Het
Parp2	T	A	14: 50,819,673	Y361N	probably damaging	Het
Pcf11	G	A	7: 92,657,831	P1043L	probably damaging	Het
Phf24	G	T	4: 42,933,761	V48L	possibly damaging	Het
Pkn1	C	A	8: 83,672,324	C678F	probably damaging	Het
Plcl2	T	C	17: 50,607,982	L673P	probably damaging	Het
Ppp1r3c	A	T	19: 36,734,217	F51Y	possibly damaging	Het
Rem2	T	C	14: 54,476,297		probably benign	Het
Smpdl3b	A	G	4: 132,745,138	V108A	probably damaging	Het
Sncaip	A	G	18: 52,868,709	T101A	probably benign	Het
Stk11	T	C	10: 80,126,086	V47A	probably damaging	Het
Tmpo	A	C	10: 91,163,096	I276M	probably benign	Het
Trim55	G	T	3: 19,671,092	V258L	possibly damaging	Het
Ttn	A	G	2: 76,730,412	V29215A	probably damaging	Het
Ubr4	T	G	4: 139,430,223	S2364A	probably benign	Het
Unc79	T	A	12: 103,079,070		probably null	Het
Upb1	T	C	10: 75,415,083		probably null	Het
Usp47	T	C	7: 112,056,580	S155P	possibly damaging	Het
Zfp628	A	T	7: 4,919,733	Q318L	probably benign	Het
Zfp729b	A	T	13: 67,591,134	V1004E	probably benign	Het

Other mutations in Enpp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Enpp3	APN	10	24787772	missense	probably benign	0.00
IGL00778:Enpp3	APN	10	24798262	missense	probably damaging	1.00
IGL01147:Enpp3	APN	10	24774907	missense	probably damaging	1.00
IGL01343:Enpp3	APN	10	24805922	nonsense	probably null
IGL01642:Enpp3	APN	10	24798269	missense	probably damaging	1.00
IGL01814:Enpp3	APN	10	24792025	missense	possibly damaging	0.68
IGL02083:Enpp3	APN	10	24776794	missense	probably damaging	1.00
IGL02152:Enpp3	APN	10	24774002	missense	probably damaging	1.00
IGL02186:Enpp3	APN	10	24791983	splice site	probably benign
IGL02517:Enpp3	APN	10	24809848	splice site	probably benign
IGL02956:Enpp3	APN	10	24774943	splice site	probably benign
R0017:Enpp3	UTSW	10	24799153	splice site	probably null
R0042:Enpp3	UTSW	10	24774824	missense	probably damaging	1.00
R0110:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0218:Enpp3	UTSW	10	24776869	missense	possibly damaging	0.80
R0403:Enpp3	UTSW	10	24804436	missense	probably damaging	1.00
R0433:Enpp3	UTSW	10	24820597	missense	probably benign	0.00
R0510:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0826:Enpp3	UTSW	10	24795716	missense	probably damaging	1.00
R1245:Enpp3	UTSW	10	24784953	splice site	probably benign
R1261:Enpp3	UTSW	10	24774934	missense	probably damaging	0.97
R1633:Enpp3	UTSW	10	24795782	missense	probably damaging	1.00
R1903:Enpp3	UTSW	10	24778789	missense	probably damaging	1.00
R1913:Enpp3	UTSW	10	24776771	nonsense	probably null
R1966:Enpp3	UTSW	10	24807491	missense	probably damaging	0.99
R2157:Enpp3	UTSW	10	24776878	missense	probably damaging	1.00
R2179:Enpp3	UTSW	10	24805895	missense	probably benign	0.00
R2380:Enpp3	UTSW	10	24776872	missense	probably benign
R2410:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R3794:Enpp3	UTSW	10	24831732	splice site	probably null
R3896:Enpp3	UTSW	10	24777949	missense	possibly damaging	0.79
R4334:Enpp3	UTSW	10	24793589	missense	probably damaging	1.00
R4569:Enpp3	UTSW	10	24776882	missense	probably damaging	1.00
R4766:Enpp3	UTSW	10	24773927	missense	probably damaging	1.00
R4951:Enpp3	UTSW	10	24798277	missense	probably damaging	1.00
R4998:Enpp3	UTSW	10	24807538	missense	probably benign	0.01
R5045:Enpp3	UTSW	10	24776767	missense	probably damaging	1.00
R5276:Enpp3	UTSW	10	24809916	missense	probably damaging	1.00
R5331:Enpp3	UTSW	10	24808160	missense	probably damaging	1.00
R5569:Enpp3	UTSW	10	24778821	missense	probably damaging	0.98
R5975:Enpp3	UTSW	10	24774842	missense	probably benign	0.37
R6117:Enpp3	UTSW	10	24787852	missense	probably damaging	1.00
R6419:Enpp3	UTSW	10	24808191	missense	probably damaging	1.00
R6677:Enpp3	UTSW	10	24777957	missense	possibly damaging	0.88
R6735:Enpp3	UTSW	10	24807453	missense	probably damaging	1.00
R6833:Enpp3	UTSW	10	24809870	missense	probably damaging	1.00
R6999:Enpp3	UTSW	10	24808166	missense	probably damaging	1.00
R7022:Enpp3	UTSW	10	24826195	missense	probably damaging	0.99
R7173:Enpp3	UTSW	10	24774047	missense	probably damaging	1.00
R7224:Enpp3	UTSW	10	24776884	missense	possibly damaging	0.63
R7227:Enpp3	UTSW	10	24817844	missense	unknown
R7487:Enpp3	UTSW	10	24805923	missense	probably benign	0.02
R7529:Enpp3	UTSW	10	24798174	missense	probably damaging	0.97
R7583:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R7692:Enpp3	UTSW	10	24784841	nonsense	probably null
X0026:Enpp3	UTSW	10	24826242	missense	probably damaging	1.00
Z1176:Enpp3	UTSW	10	24787793	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAATGGGACTCCTCTCTGGAAAAGC -3'
(R):5'- CATGGGCAATTACTGGAGTGGAATGT -3'

Sequencing Primer
(F):5'- ATTGATGGCTCAGACTCTACATTTC -3'
(R):5'- ATTACTGGAGTGGAATGTGGTGC -3'

Posted On

2013-05-23