Incidental Mutation 'R5135:Dlgap5'
ID 396164
Institutional Source Beutler Lab
Gene Symbol Dlgap5
Ensembl Gene ENSMUSG00000037544
Gene Name DLG associated protein 5
Synonyms Dlg7, C86398, Hurp
MMRRC Submission 043261-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.820) question?
Stock # R5135 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 47387779-47418407 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 47399665 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 452 (R452H)
Ref Sequence ENSEMBL: ENSMUSP00000154283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043296] [ENSMUST00000178661] [ENSMUST00000180299]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000043296
AA Change: R452H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040416
Gene: ENSMUSG00000037544
AA Change: R452H

DomainStartEndE-ValueType
coiled coil region 86 116 N/A INTRINSIC
Pfam:GKAP 327 590 2.2e-38 PFAM
low complexity region 735 757 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111778
AA Change: R250H
SMART Domains Protein: ENSMUSP00000107408
Gene: ENSMUSG00000037544
AA Change: R250H

DomainStartEndE-ValueType
Pfam:GKAP 78 303 3.9e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178661
AA Change: R452H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179465
Predicted Effect probably damaging
Transcript: ENSMUST00000180299
AA Change: R452H

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.7486 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (82/84)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display female infertility resulting from a defect in decidualization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik T C 1: 184,033,506 S119G probably benign Het
4930553M12Rik G T 4: 88,868,271 H37N unknown Het
Adam10 T A 9: 70,766,074 C496S probably damaging Het
Akap2 G T 4: 57,855,912 A414S probably benign Het
Aldh18a1 A C 19: 40,554,817 probably benign Het
Alox5 A G 6: 116,413,786 F468S probably benign Het
Ankrd50 T C 3: 38,455,803 H805R probably damaging Het
Ap2s1 T A 7: 16,747,323 D72E probably damaging Het
Apaf1 T C 10: 91,060,094 Y372C probably damaging Het
Apob C T 12: 8,010,086 T2823I probably damaging Het
Bhmt A G 13: 93,627,323 V70A probably damaging Het
Cdc42bpg T A 19: 6,320,618 L1247H probably damaging Het
Cel A G 2: 28,559,423 V264A probably benign Het
Celsr2 T C 3: 108,398,659 N2043S probably damaging Het
Clca4a A T 3: 144,954,946 W706R probably damaging Het
Col22a1 G T 15: 71,799,337 P1058Q unknown Het
Cyp4a14 A G 4: 115,489,960 probably null Het
Dhx30 T G 9: 110,098,795 R55S probably damaging Het
Dnah12 T A 14: 26,770,477 D1191E probably damaging Het
Dock3 A T 9: 106,932,997 I164N probably damaging Het
Edrf1 T A 7: 133,651,044 M436K probably benign Het
Eif2ak2 T A 17: 78,866,345 Y268F probably damaging Het
Evi2a G A 11: 79,527,451 T111M possibly damaging Het
Fzd4 A G 7: 89,407,501 E252G probably damaging Het
Gcm2 A G 13: 41,102,959 V438A probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gm21994 A T 2: 150,255,490 Y34* probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm4846 T C 1: 166,483,982 D436G probably damaging Het
Gm5414 T A 15: 101,627,768 I141F probably damaging Het
Gm6185 T A 1: 161,198,231 noncoding transcript Het
Grip2 T C 6: 91,773,916 E776G possibly damaging Het
H2-Ob T A 17: 34,243,516 V160E probably benign Het
Hormad1 T C 3: 95,585,220 probably benign Het
Ighv2-1 A T 12: 113,574,462 probably benign Het
Igkv4-92 A T 6: 68,755,554 C14S probably benign Het
Iqsec3 T C 6: 121,383,919 I993M probably damaging Het
Kdm5b T A 1: 134,588,746 probably benign Het
Kitl T C 10: 100,088,222 probably null Het
Klhl26 G T 8: 70,452,718 R100S probably benign Het
Kpna4 C T 3: 69,092,809 probably null Het
Lama5 T A 2: 180,202,220 N383Y possibly damaging Het
Large1 T G 8: 72,818,096 I685L probably benign Het
Larp4b A G 13: 9,170,737 E590G probably damaging Het
Liph A T 16: 21,956,165 C425* probably null Het
Lrrc31 A T 3: 30,684,890 C327* probably null Het
Lrrc36 T C 8: 105,463,898 V733A probably benign Het
Mmel1 T A 4: 154,882,324 I83K probably benign Het
Myo16 G T 8: 10,476,114 V885L probably benign Het
Naip2 A T 13: 100,179,440 N277K probably damaging Het
Ncapg2 T A 12: 116,427,786 I485N possibly damaging Het
Npc1l1 A T 11: 6,224,245 Y687N possibly damaging Het
Obscn A T 11: 59,129,653 V922E probably damaging Het
Oc90 A G 15: 65,883,830 S223P probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1253 A T 2: 89,751,895 L311H possibly damaging Het
Olfr1508 T C 14: 52,463,854 I52V probably benign Het
Pdlim5 C T 3: 142,304,365 R174H probably benign Het
Pex5l G T 3: 32,955,831 A386E probably damaging Het
Plcxd1 T A 5: 110,101,363 probably benign Het
Pramef8 T G 4: 143,419,009 S349R probably benign Het
Prl8a1 A T 13: 27,579,819 probably null Het
Ryr2 G T 13: 11,662,130 N3278K probably benign Het
Sacm1l A G 9: 123,577,025 M324V probably benign Het
Sdad1 T C 5: 92,303,934 T143A probably benign Het
Sec11a A T 7: 80,923,064 probably benign Het
Sema6a A G 18: 47,291,172 V223A probably damaging Het
Serpinb6c A G 13: 33,880,097 V325A probably damaging Het
Slc4a2 G A 5: 24,430,127 A177T possibly damaging Het
Slc5a4a A G 10: 76,147,594 N22D unknown Het
Stard13 C T 5: 151,062,767 W308* probably null Het
Tanc2 C T 11: 105,857,553 L504F possibly damaging Het
Tfap2e G T 4: 126,720,544 N282K probably damaging Het
Uhrf1bp1l T C 10: 89,789,355 I48T probably damaging Het
Usp36 G T 11: 118,264,905 T682K possibly damaging Het
Zc3h11a T C 1: 133,633,789 T315A probably benign Het
Zfa-ps T A 10: 52,543,022 noncoding transcript Het
Zfp663 A T 2: 165,353,670 C210S possibly damaging Het
Zfp747 T C 7: 127,374,394 I201M probably damaging Het
Zic4 C T 9: 91,384,152 T276M probably damaging Het
Other mutations in Dlgap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Dlgap5 APN 14 47398468 missense probably damaging 1.00
IGL01110:Dlgap5 APN 14 47394326 splice site probably benign
IGL02943:Dlgap5 APN 14 47412976 critical splice donor site probably null
PIT4453001:Dlgap5 UTSW 14 47401522 frame shift probably null
R0189:Dlgap5 UTSW 14 47412975 splice site probably null
R0383:Dlgap5 UTSW 14 47410361 missense probably benign 0.01
R1078:Dlgap5 UTSW 14 47399566 missense probably damaging 1.00
R1915:Dlgap5 UTSW 14 47407773 missense probably benign 0.00
R1959:Dlgap5 UTSW 14 47416386 missense possibly damaging 0.88
R2051:Dlgap5 UTSW 14 47411484 missense probably benign 0.01
R2145:Dlgap5 UTSW 14 47395923 nonsense probably null
R2922:Dlgap5 UTSW 14 47390441 critical splice donor site probably null
R4261:Dlgap5 UTSW 14 47413788 missense probably damaging 1.00
R4607:Dlgap5 UTSW 14 47413018 missense possibly damaging 0.87
R4724:Dlgap5 UTSW 14 47401520 critical splice donor site probably null
R4898:Dlgap5 UTSW 14 47413819 missense probably benign 0.01
R5154:Dlgap5 UTSW 14 47413720 missense probably damaging 1.00
R5650:Dlgap5 UTSW 14 47411739 missense probably benign 0.01
R5849:Dlgap5 UTSW 14 47389435 missense possibly damaging 0.95
R5958:Dlgap5 UTSW 14 47413754 missense probably damaging 1.00
R6845:Dlgap5 UTSW 14 47416563 missense possibly damaging 0.79
R7163:Dlgap5 UTSW 14 47399638 missense probably damaging 1.00
R7529:Dlgap5 UTSW 14 47416419 missense probably damaging 1.00
R7646:Dlgap5 UTSW 14 47399519 critical splice donor site probably null
R8029:Dlgap5 UTSW 14 47416440 missense probably benign 0.01
R8084:Dlgap5 UTSW 14 47407841 missense probably benign 0.00
R9126:Dlgap5 UTSW 14 47401532 missense probably damaging 1.00
R9166:Dlgap5 UTSW 14 47413749 missense probably damaging 1.00
Z1177:Dlgap5 UTSW 14 47388063 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTCAGAAGCAGATGTGGGC -3'
(R):5'- TGAAGCAAGGTCCTCATGC -3'

Sequencing Primer
(F):5'- AGATGTGGGCAGCACACCTG -3'
(R):5'- GGAATTGAATTCAGGACCTCTGCTC -3'
Posted On 2016-06-21