Incidental Mutation 'R5135:Cdc42bpg'
ID396173
Institutional Source Beutler Lab
Gene Symbol Cdc42bpg
Ensembl Gene ENSMUSG00000024769
Gene NameCDC42 binding protein kinase gamma (DMPK-like)
SynonymsMRCKgamma
MMRRC Submission 043261-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.344) question?
Stock #R5135 (G1)
Quality Score179
Status Validated
Chromosome19
Chromosomal Location6306456-6325652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6320618 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 1247 (L1247H)
Ref Sequence ENSEMBL: ENSMUSP00000025681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025681]
Predicted Effect probably damaging
Transcript: ENSMUST00000025681
AA Change: L1247H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025681
Gene: ENSMUSG00000024769
AA Change: L1247H

DomainStartEndE-ValueType
low complexity region 21 31 N/A INTRINSIC
S_TKc 71 337 1.63e-87 SMART
S_TK_X 338 400 7.85e-12 SMART
coiled coil region 444 551 N/A INTRINSIC
coiled coil region 630 675 N/A INTRINSIC
Pfam:DMPK_coil 743 801 4.6e-21 PFAM
low complexity region 861 873 N/A INTRINSIC
C1 878 926 1.78e-7 SMART
PH 947 1067 3.57e-10 SMART
Pfam:CNH 1096 1362 7.5e-56 PFAM
low complexity region 1401 1412 N/A INTRINSIC
low complexity region 1535 1551 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141854
Meta Mutation Damage Score 0.154 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (82/84)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik T C 1: 184,033,506 S119G probably benign Het
4930553M12Rik G T 4: 88,868,271 H37N unknown Het
Adam10 T A 9: 70,766,074 C496S probably damaging Het
Akap2 G T 4: 57,855,912 A414S probably benign Het
Aldh18a1 A C 19: 40,554,817 probably benign Het
Alox5 A G 6: 116,413,786 F468S probably benign Het
Ankrd50 T C 3: 38,455,803 H805R probably damaging Het
Ap2s1 T A 7: 16,747,323 D72E probably damaging Het
Apaf1 T C 10: 91,060,094 Y372C probably damaging Het
Apob C T 12: 8,010,086 T2823I probably damaging Het
Bhmt A G 13: 93,627,323 V70A probably damaging Het
Cel A G 2: 28,559,423 V264A probably benign Het
Celsr2 T C 3: 108,398,659 N2043S probably damaging Het
Clca4a A T 3: 144,954,946 W706R probably damaging Het
Col22a1 G T 15: 71,799,337 P1058Q unknown Het
Cyp4a14 A G 4: 115,489,960 probably null Het
Dhx30 T G 9: 110,098,795 R55S probably damaging Het
Dlgap5 C T 14: 47,399,665 R452H probably damaging Het
Dnah12 T A 14: 26,770,477 D1191E probably damaging Het
Dock3 A T 9: 106,932,997 I164N probably damaging Het
Edrf1 T A 7: 133,651,044 M436K probably benign Het
Eif2ak2 T A 17: 78,866,345 Y268F probably damaging Het
Evi2a G A 11: 79,527,451 T111M possibly damaging Het
Fzd4 A G 7: 89,407,501 E252G probably damaging Het
Gcm2 A G 13: 41,102,959 V438A probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gm21994 A T 2: 150,255,490 Y34* probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm4846 T C 1: 166,483,982 D436G probably damaging Het
Gm5414 T A 15: 101,627,768 I141F probably damaging Het
Gm6185 T A 1: 161,198,231 noncoding transcript Het
Grip2 T C 6: 91,773,916 E776G possibly damaging Het
H2-Ob T A 17: 34,243,516 V160E probably benign Het
Hormad1 T C 3: 95,585,220 probably benign Het
Ighv2-1 A T 12: 113,574,462 probably benign Het
Igkv4-92 A T 6: 68,755,554 C14S probably benign Het
Iqsec3 T C 6: 121,383,919 I993M probably damaging Het
Kdm5b T A 1: 134,588,746 probably benign Het
Kitl T C 10: 100,088,222 probably null Het
Klhl26 G T 8: 70,452,718 R100S probably benign Het
Kpna4 C T 3: 69,092,809 probably null Het
Lama5 T A 2: 180,202,220 N383Y possibly damaging Het
Large1 T G 8: 72,818,096 I685L probably benign Het
Larp4b A G 13: 9,170,737 E590G probably damaging Het
Liph A T 16: 21,956,165 C425* probably null Het
Lrrc31 A T 3: 30,684,890 C327* probably null Het
Lrrc36 T C 8: 105,463,898 V733A probably benign Het
Mmel1 T A 4: 154,882,324 I83K probably benign Het
Myo16 G T 8: 10,476,114 V885L probably benign Het
Naip2 A T 13: 100,179,440 N277K probably damaging Het
Ncapg2 T A 12: 116,427,786 I485N possibly damaging Het
Npc1l1 A T 11: 6,224,245 Y687N possibly damaging Het
Obscn A T 11: 59,129,653 V922E probably damaging Het
Oc90 A G 15: 65,883,830 S223P probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1253 A T 2: 89,751,895 L311H possibly damaging Het
Olfr1508 T C 14: 52,463,854 I52V probably benign Het
Pdlim5 C T 3: 142,304,365 R174H probably benign Het
Pex5l G T 3: 32,955,831 A386E probably damaging Het
Plcxd1 T A 5: 110,101,363 probably benign Het
Pramef8 T G 4: 143,419,009 S349R probably benign Het
Prl8a1 A T 13: 27,579,819 probably null Het
Ryr2 G T 13: 11,662,130 N3278K probably benign Het
Sacm1l A G 9: 123,577,025 M324V probably benign Het
Sdad1 T C 5: 92,303,934 T143A probably benign Het
Sec11a A T 7: 80,923,064 probably benign Het
Sema6a A G 18: 47,291,172 V223A probably damaging Het
Serpinb6c A G 13: 33,880,097 V325A probably damaging Het
Slc4a2 G A 5: 24,430,127 A177T possibly damaging Het
Slc5a4a A G 10: 76,147,594 N22D unknown Het
Stard13 C T 5: 151,062,767 W308* probably null Het
Tanc2 C T 11: 105,857,553 L504F possibly damaging Het
Tfap2e G T 4: 126,720,544 N282K probably damaging Het
Uhrf1bp1l T C 10: 89,789,355 I48T probably damaging Het
Usp36 G T 11: 118,264,905 T682K possibly damaging Het
Zc3h11a T C 1: 133,633,789 T315A probably benign Het
Zfa-ps T A 10: 52,543,022 noncoding transcript Het
Zfp663 A T 2: 165,353,670 C210S possibly damaging Het
Zfp747 T C 7: 127,374,394 I201M probably damaging Het
Zic4 C T 9: 91,384,152 T276M probably damaging Het
Other mutations in Cdc42bpg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Cdc42bpg APN 19 6312205 splice site probably benign
IGL01415:Cdc42bpg APN 19 6310851 missense probably damaging 1.00
IGL01517:Cdc42bpg APN 19 6318437 missense probably damaging 1.00
IGL01585:Cdc42bpg APN 19 6320432 missense possibly damaging 0.93
IGL01743:Cdc42bpg APN 19 6309823 critical splice donor site probably null
IGL01930:Cdc42bpg APN 19 6311368 missense probably damaging 1.00
IGL02092:Cdc42bpg APN 19 6316826 splice site probably benign
IGL02355:Cdc42bpg APN 19 6310809 missense possibly damaging 0.93
IGL02362:Cdc42bpg APN 19 6310809 missense possibly damaging 0.93
IGL02498:Cdc42bpg APN 19 6322793 missense probably benign
IGL03004:Cdc42bpg APN 19 6311383 missense probably benign 0.38
IGL03037:Cdc42bpg APN 19 6311200 missense probably damaging 1.00
PIT1430001:Cdc42bpg UTSW 19 6322552 splice site probably null
R0304:Cdc42bpg UTSW 19 6317248 missense probably damaging 0.99
R0367:Cdc42bpg UTSW 19 6311395 missense probably damaging 1.00
R0412:Cdc42bpg UTSW 19 6313457 missense probably damaging 1.00
R0742:Cdc42bpg UTSW 19 6318575 critical splice donor site probably null
R1026:Cdc42bpg UTSW 19 6317187 missense probably damaging 1.00
R1056:Cdc42bpg UTSW 19 6314021 missense probably benign 0.10
R1065:Cdc42bpg UTSW 19 6322826 missense probably damaging 1.00
R1476:Cdc42bpg UTSW 19 6313782 missense probably damaging 0.99
R1854:Cdc42bpg UTSW 19 6320807 missense possibly damaging 0.67
R1936:Cdc42bpg UTSW 19 6310309 missense probably damaging 1.00
R1962:Cdc42bpg UTSW 19 6306855 missense probably damaging 1.00
R2070:Cdc42bpg UTSW 19 6320488 missense probably damaging 1.00
R2167:Cdc42bpg UTSW 19 6317677 missense probably damaging 1.00
R3826:Cdc42bpg UTSW 19 6317645 missense probably damaging 0.99
R3829:Cdc42bpg UTSW 19 6317645 missense probably damaging 0.99
R4190:Cdc42bpg UTSW 19 6321681 missense probably damaging 1.00
R4249:Cdc42bpg UTSW 19 6315266 missense possibly damaging 0.65
R4499:Cdc42bpg UTSW 19 6320555 missense possibly damaging 0.69
R4731:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4732:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4733:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4797:Cdc42bpg UTSW 19 6320447 missense probably damaging 1.00
R4831:Cdc42bpg UTSW 19 6311335 missense probably damaging 0.97
R4984:Cdc42bpg UTSW 19 6316223 missense possibly damaging 0.88
R5092:Cdc42bpg UTSW 19 6313220 missense probably benign 0.01
R5183:Cdc42bpg UTSW 19 6321805 intron probably benign
R5208:Cdc42bpg UTSW 19 6321720 missense probably benign 0.01
R5240:Cdc42bpg UTSW 19 6315899 missense probably damaging 1.00
R5475:Cdc42bpg UTSW 19 6311071 missense probably damaging 0.99
R5703:Cdc42bpg UTSW 19 6322673 missense possibly damaging 0.87
R5876:Cdc42bpg UTSW 19 6310815 missense probably damaging 1.00
R6024:Cdc42bpg UTSW 19 6317496 missense probably damaging 1.00
R6266:Cdc42bpg UTSW 19 6311473 missense probably damaging 1.00
R6450:Cdc42bpg UTSW 19 6314488 splice site probably null
R6493:Cdc42bpg UTSW 19 6318455 missense probably damaging 0.96
R6983:Cdc42bpg UTSW 19 6321668 missense probably damaging 1.00
R7080:Cdc42bpg UTSW 19 6315189 missense probably damaging 0.97
R7125:Cdc42bpg UTSW 19 6322291 missense probably damaging 1.00
R7183:Cdc42bpg UTSW 19 6310797 missense probably damaging 1.00
R7317:Cdc42bpg UTSW 19 6314504 missense probably benign 0.11
R7426:Cdc42bpg UTSW 19 6318398 missense probably damaging 1.00
R7504:Cdc42bpg UTSW 19 6306784 missense possibly damaging 0.85
R7530:Cdc42bpg UTSW 19 6322275 missense probably benign 0.21
R7530:Cdc42bpg UTSW 19 6322276 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TCACAGCAATGGTACCAGAG -3'
(R):5'- AGCACTATCCACGTAGACGC -3'

Sequencing Primer
(F):5'- ACCGCAGACATCTTCCAGGTG -3'
(R):5'- ACGTAGACGCCGGCAGTG -3'
Posted On2016-06-21