Incidental Mutation 'R5135:Aldh18a1'
ID396174
Institutional Source Beutler Lab
Gene Symbol Aldh18a1
Ensembl Gene ENSMUSG00000025007
Gene Namealdehyde dehydrogenase 18 family, member A1
Synonyms2810433K04Rik, Pycs
MMRRC Submission 043261-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5135 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location40550257-40588463 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to C at 40554817 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025979] [ENSMUST00000175967] [ENSMUST00000176939]
Predicted Effect probably benign
Transcript: ENSMUST00000025979
SMART Domains Protein: ENSMUSP00000025979
Gene: ENSMUSG00000025007

DomainStartEndE-ValueType
Pfam:AA_kinase 71 329 1e-41 PFAM
Pfam:Aldedh 350 659 3.9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155613
Predicted Effect probably benign
Transcript: ENSMUST00000175967
SMART Domains Protein: ENSMUSP00000135419
Gene: ENSMUSG00000025007

DomainStartEndE-ValueType
PDB:2H5G|B 1 83 9e-52 PDB
SCOP:d1a4sa_ 11 95 1e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176939
SMART Domains Protein: ENSMUSP00000135426
Gene: ENSMUSG00000025007

DomainStartEndE-ValueType
Pfam:AA_kinase 71 327 1.9e-39 PFAM
Pfam:Aldedh 351 665 3.4e-11 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the aldehyde dehydrogenase family and encodes a bifunctional ATP- and NADPH-dependent mitochondrial enzyme with both gamma-glutamyl kinase and gamma-glutamyl phosphate reductase activities. The encoded protein catalyzes the reduction of glutamate to delta1-pyrroline-5-carboxylate, a critical step in the de novo biosynthesis of proline, ornithine and arginine. Mutations in this gene lead to hyperammonemia, hypoornithinemia, hypocitrullinemia, hypoargininemia and hypoprolinemia and may be associated with neurodegeneration, cataracts and connective tissue diseases. Alternatively spliced transcript variants, encoding different isoforms, have been described for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik T C 1: 184,033,506 S119G probably benign Het
4930553M12Rik G T 4: 88,868,271 H37N unknown Het
Adam10 T A 9: 70,766,074 C496S probably damaging Het
Akap2 G T 4: 57,855,912 A414S probably benign Het
Alox5 A G 6: 116,413,786 F468S probably benign Het
Ankrd50 T C 3: 38,455,803 H805R probably damaging Het
Ap2s1 T A 7: 16,747,323 D72E probably damaging Het
Apaf1 T C 10: 91,060,094 Y372C probably damaging Het
Apob C T 12: 8,010,086 T2823I probably damaging Het
Bhmt A G 13: 93,627,323 V70A probably damaging Het
Cdc42bpg T A 19: 6,320,618 L1247H probably damaging Het
Cel A G 2: 28,559,423 V264A probably benign Het
Celsr2 T C 3: 108,398,659 N2043S probably damaging Het
Clca4a A T 3: 144,954,946 W706R probably damaging Het
Col22a1 G T 15: 71,799,337 P1058Q unknown Het
Cyp4a14 A G 4: 115,489,960 probably null Het
Dhx30 T G 9: 110,098,795 R55S probably damaging Het
Dlgap5 C T 14: 47,399,665 R452H probably damaging Het
Dnah12 T A 14: 26,770,477 D1191E probably damaging Het
Dock3 A T 9: 106,932,997 I164N probably damaging Het
Edrf1 T A 7: 133,651,044 M436K probably benign Het
Eif2ak2 T A 17: 78,866,345 Y268F probably damaging Het
Evi2a G A 11: 79,527,451 T111M possibly damaging Het
Fzd4 A G 7: 89,407,501 E252G probably damaging Het
Gcm2 A G 13: 41,102,959 V438A probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gm21994 A T 2: 150,255,490 Y34* probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm4846 T C 1: 166,483,982 D436G probably damaging Het
Gm5414 T A 15: 101,627,768 I141F probably damaging Het
Gm6185 T A 1: 161,198,231 noncoding transcript Het
Grip2 T C 6: 91,773,916 E776G possibly damaging Het
H2-Ob T A 17: 34,243,516 V160E probably benign Het
Hormad1 T C 3: 95,585,220 probably benign Het
Ighv2-1 A T 12: 113,574,462 probably benign Het
Igkv4-92 A T 6: 68,755,554 C14S probably benign Het
Iqsec3 T C 6: 121,383,919 I993M probably damaging Het
Kdm5b T A 1: 134,588,746 probably benign Het
Kitl T C 10: 100,088,222 probably null Het
Klhl26 G T 8: 70,452,718 R100S probably benign Het
Kpna4 C T 3: 69,092,809 probably null Het
Lama5 T A 2: 180,202,220 N383Y possibly damaging Het
Large1 T G 8: 72,818,096 I685L probably benign Het
Larp4b A G 13: 9,170,737 E590G probably damaging Het
Liph A T 16: 21,956,165 C425* probably null Het
Lrrc31 A T 3: 30,684,890 C327* probably null Het
Lrrc36 T C 8: 105,463,898 V733A probably benign Het
Mmel1 T A 4: 154,882,324 I83K probably benign Het
Myo16 G T 8: 10,476,114 V885L probably benign Het
Naip2 A T 13: 100,179,440 N277K probably damaging Het
Ncapg2 T A 12: 116,427,786 I485N possibly damaging Het
Npc1l1 A T 11: 6,224,245 Y687N possibly damaging Het
Obscn A T 11: 59,129,653 V922E probably damaging Het
Oc90 A G 15: 65,883,830 S223P probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1253 A T 2: 89,751,895 L311H possibly damaging Het
Olfr1508 T C 14: 52,463,854 I52V probably benign Het
Pdlim5 C T 3: 142,304,365 R174H probably benign Het
Pex5l G T 3: 32,955,831 A386E probably damaging Het
Plcxd1 T A 5: 110,101,363 probably benign Het
Pramef8 T G 4: 143,419,009 S349R probably benign Het
Prl8a1 A T 13: 27,579,819 probably null Het
Ryr2 G T 13: 11,662,130 N3278K probably benign Het
Sacm1l A G 9: 123,577,025 M324V probably benign Het
Sdad1 T C 5: 92,303,934 T143A probably benign Het
Sec11a A T 7: 80,923,064 probably benign Het
Sema6a A G 18: 47,291,172 V223A probably damaging Het
Serpinb6c A G 13: 33,880,097 V325A probably damaging Het
Slc4a2 G A 5: 24,430,127 A177T possibly damaging Het
Slc5a4a A G 10: 76,147,594 N22D unknown Het
Stard13 C T 5: 151,062,767 W308* probably null Het
Tanc2 C T 11: 105,857,553 L504F possibly damaging Het
Tfap2e G T 4: 126,720,544 N282K probably damaging Het
Uhrf1bp1l T C 10: 89,789,355 I48T probably damaging Het
Usp36 G T 11: 118,264,905 T682K possibly damaging Het
Zc3h11a T C 1: 133,633,789 T315A probably benign Het
Zfa-ps T A 10: 52,543,022 noncoding transcript Het
Zfp663 A T 2: 165,353,670 C210S possibly damaging Het
Zfp747 T C 7: 127,374,394 I201M probably damaging Het
Zic4 C T 9: 91,384,152 T276M probably damaging Het
Other mutations in Aldh18a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Aldh18a1 APN 19 40569181 splice site probably benign
IGL02353:Aldh18a1 APN 19 40577920 missense probably damaging 0.98
IGL02360:Aldh18a1 APN 19 40577920 missense probably damaging 0.98
IGL02974:Aldh18a1 APN 19 40569084 missense probably damaging 0.96
IGL03295:Aldh18a1 APN 19 40562942 missense probably damaging 1.00
PIT4498001:Aldh18a1 UTSW 19 40574356 missense probably benign
R0267:Aldh18a1 UTSW 19 40573789 missense probably benign 0.25
R0498:Aldh18a1 UTSW 19 40574272 missense probably benign 0.29
R1140:Aldh18a1 UTSW 19 40574285 missense probably benign 0.01
R1142:Aldh18a1 UTSW 19 40551213 missense probably damaging 0.97
R1509:Aldh18a1 UTSW 19 40557483 missense probably damaging 0.98
R1640:Aldh18a1 UTSW 19 40585499 missense probably benign
R1721:Aldh18a1 UTSW 19 40564838 missense probably damaging 1.00
R3012:Aldh18a1 UTSW 19 40557691 nonsense probably null
R3085:Aldh18a1 UTSW 19 40574369 missense probably benign
R3815:Aldh18a1 UTSW 19 40570500 missense probably damaging 1.00
R3863:Aldh18a1 UTSW 19 40551314 missense probably damaging 1.00
R4156:Aldh18a1 UTSW 19 40551281 missense probably damaging 1.00
R5116:Aldh18a1 UTSW 19 40553505 missense probably benign
R5393:Aldh18a1 UTSW 19 40585567 missense probably benign 0.00
R5492:Aldh18a1 UTSW 19 40551290 missense probably damaging 1.00
R5493:Aldh18a1 UTSW 19 40551290 missense probably damaging 1.00
R5494:Aldh18a1 UTSW 19 40551290 missense probably damaging 1.00
R5957:Aldh18a1 UTSW 19 40570537 nonsense probably null
R6255:Aldh18a1 UTSW 19 40580043 missense possibly damaging 0.93
R6320:Aldh18a1 UTSW 19 40570561 missense probably benign 0.44
R6358:Aldh18a1 UTSW 19 40577678 missense possibly damaging 0.83
R6379:Aldh18a1 UTSW 19 40577770 critical splice donor site probably null
R6785:Aldh18a1 UTSW 19 40568344 missense probably damaging 1.00
R7334:Aldh18a1 UTSW 19 40551252 missense probably damaging 1.00
R7549:Aldh18a1 UTSW 19 40564847 missense probably damaging 1.00
R7935:Aldh18a1 UTSW 19 40573782 nonsense probably null
R7960:Aldh18a1 UTSW 19 40557820 missense probably benign 0.03
R8152:Aldh18a1 UTSW 19 40565012 missense probably benign 0.01
R8179:Aldh18a1 UTSW 19 40557508 missense probably damaging 1.00
R8181:Aldh18a1 UTSW 19 40557437 missense probably benign 0.27
R8222:Aldh18a1 UTSW 19 40573852 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGATCAATGGCTTCCTGG -3'
(R):5'- AAAGGCCTTTCCTGTCAGTCC -3'

Sequencing Primer
(F):5'- TCAATGGCTTCCTGGACGCTG -3'
(R):5'- CTCAAGGTCCTGTTGCTGGAAAAG -3'
Posted On2016-06-21