Incidental Mutation 'R5137:Olfr1225'
ID396184
Institutional Source Beutler Lab
Gene Symbol Olfr1225
Ensembl Gene ENSMUSG00000101918
Gene Nameolfactory receptor 1225
SynonymsMOR233-11, GA_x6K02T2Q125-50650037-50649102
MMRRC Submission 042723-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R5137 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89168380-89174669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 89170400 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 271 (V271F)
Ref Sequence ENSEMBL: ENSMUSP00000150915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000188861] [ENSMUST00000216961] [ENSMUST00000217054]
Predicted Effect probably benign
Transcript: ENSMUST00000188861
AA Change: V271F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140442
Gene: ENSMUSG00000101918
AA Change: V271F

DomainStartEndE-ValueType
low complexity region 24 32 N/A INTRINSIC
Pfam:7tm_1 39 289 5.5e-24 PFAM
Pfam:7tm_4 138 287 2.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216961
AA Change: V271F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000217054
AA Change: V271F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,069,771 V75A probably benign Het
Ace G C 11: 105,974,826 W628C probably damaging Het
Adh4 T C 3: 138,422,235 S141P probably benign Het
Apob T C 12: 8,011,384 Y3256H possibly damaging Het
B3galnt1 G T 3: 69,574,949 N326K probably benign Het
Catsperb T C 12: 101,549,811 F569L probably damaging Het
Cecr2 A G 6: 120,755,517 I225V probably benign Het
Cox5b A G 1: 36,692,429 probably null Het
Crybg1 T C 10: 43,958,336 D1953G probably damaging Het
Dnaaf5 C T 5: 139,181,460 T707M probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Ebf1 G A 11: 44,991,468 R409Q probably damaging Het
Eef2k G A 7: 120,885,422 A256T probably damaging Het
Eef2k C A 7: 120,885,423 A256D probably damaging Het
Evl C G 12: 108,681,522 T294S probably benign Het
Eya2 T C 2: 165,731,628 Y288H probably damaging Het
Ezh2 A T 6: 47,532,080 probably null Het
Fam171a1 T C 2: 3,225,389 Y395H probably benign Het
Gas2l3 C A 10: 89,413,975 R427L probably damaging Het
Gli2 T A 1: 118,855,503 I91F probably damaging Het
Gm4884 T C 7: 41,042,894 S96P probably damaging Het
Gprc5d T A 6: 135,116,033 D292V probably benign Het
Herc1 A G 9: 66,448,223 K2252R probably benign Het
Il1rl1 A T 1: 40,450,125 M346L probably benign Het
Kcna5 A T 6: 126,533,983 V394D probably damaging Het
Kcng4 A T 8: 119,625,878 M431K possibly damaging Het
Kif1bp A T 10: 62,578,241 V46E probably damaging Het
Large1 A G 8: 73,048,309 F258L possibly damaging Het
Mapkbp1 T A 2: 120,022,181 C1001S probably damaging Het
Micu1 A G 10: 59,827,232 Q328R probably benign Het
Mmp11 G A 10: 75,925,456 P437S probably damaging Het
Msh6 T A 17: 87,980,288 F119I possibly damaging Het
Myo6 A G 9: 80,242,249 E159G probably damaging Het
Negr1 T A 3: 157,016,196 Y136N probably damaging Het
Nol9 T A 4: 152,045,971 C321S probably damaging Het
Nos1 T C 5: 117,905,313 F551S probably benign Het
Nup153 C A 13: 46,684,153 G1198C probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr395 T C 11: 73,906,626 I289V probably damaging Het
Olfr606 A G 7: 103,451,712 Y125C probably damaging Het
Olfr606 C A 7: 103,451,713 Y125* probably null Het
Omd T C 13: 49,590,076 S201P probably benign Het
Oxct1 G T 15: 4,035,350 A57S probably benign Het
Pcdhga7 T G 18: 37,717,380 S813R probably damaging Het
Pcmtd2 A T 2: 181,854,994 I255F possibly damaging Het
Pdk1 T G 2: 71,883,569 M186R possibly damaging Het
Pelp1 T C 11: 70,395,099 T648A probably damaging Het
Phldb2 A T 16: 45,808,258 S570R possibly damaging Het
Pramef25 T A 4: 143,949,120 T379S probably benign Het
Ptprj T C 2: 90,469,648 T270A possibly damaging Het
Reln C T 5: 21,955,181 G2130D probably damaging Het
Rims1 A T 1: 22,288,620 Y663* probably null Het
Rit2 T C 18: 31,153,764 T123A probably benign Het
Rmdn2 A T 17: 79,667,989 E302D probably benign Het
Ryr1 T C 7: 29,101,858 E827G possibly damaging Het
Siglec1 C T 2: 131,081,344 G494R probably damaging Het
Slc16a14 T A 1: 84,912,597 Y329F probably damaging Het
Slc35d1 A T 4: 103,214,781 L8Q possibly damaging Het
Smpdl3a C T 10: 57,801,067 S57L possibly damaging Het
Snx9 T C 17: 5,928,253 V566A probably damaging Het
Spaca1 A T 4: 34,029,095 I126N probably damaging Het
Spred1 T G 2: 117,163,571 I94S probably damaging Het
Tardbp T C 4: 148,622,037 D105G possibly damaging Het
Tet2 T C 3: 133,476,565 S1213G probably benign Het
Trak1 A T 9: 121,367,055 probably benign Het
Trem3 G A 17: 48,249,728 V76M possibly damaging Het
Ttc13 G T 8: 124,694,935 Y250* probably null Het
Ttll5 T G 12: 85,923,045 S714R possibly damaging Het
Ube2l6 T G 2: 84,802,876 probably null Het
Ubr3 T C 2: 69,973,335 S1090P probably damaging Het
Uhrf1bp1 T G 17: 27,876,990 probably null Het
Vezt T C 10: 93,970,510 T680A probably benign Het
Virma A G 4: 11,546,297 K1762E probably damaging Het
Vps53 A G 11: 76,166,248 S57P probably damaging Het
Vwa7 G T 17: 35,017,846 D130Y probably damaging Het
Vwa8 T G 14: 79,064,902 F1004V probably damaging Het
Zfp35 A T 18: 24,004,137 K513* probably null Het
Zfp384 ACAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGC 6: 125,036,509 probably benign Het
Zfp521 C A 18: 13,845,448 C636F probably damaging Het
Other mutations in Olfr1225
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03230:Olfr1225 APN 2 89171089 missense possibly damaging 0.53
IGL03381:Olfr1225 APN 2 89171179 missense possibly damaging 0.49
IGL03147:Olfr1225 UTSW 2 89170972 missense probably benign 0.03
PIT4458001:Olfr1225 UTSW 2 89170633 missense probably benign 0.02
R0100:Olfr1225 UTSW 2 89171087 missense probably benign 0.00
R0373:Olfr1225 UTSW 2 89170413 missense probably benign 0.02
R0482:Olfr1225 UTSW 2 89170631 missense probably benign 0.37
R0491:Olfr1225 UTSW 2 89170360 missense probably benign 0.07
R0548:Olfr1225 UTSW 2 89170648 missense probably damaging 1.00
R1123:Olfr1225 UTSW 2 89170868 missense possibly damaging 0.89
R1511:Olfr1225 UTSW 2 89170937 missense probably damaging 1.00
R1565:Olfr1225 UTSW 2 89170627 missense probably benign 0.01
R4204:Olfr1225 UTSW 2 89170780 missense probably benign 0.13
R4580:Olfr1225 UTSW 2 89171200 missense probably benign 0.01
R4669:Olfr1225 UTSW 2 89170901 missense probably damaging 1.00
R6391:Olfr1225 UTSW 2 89170598 missense probably benign 0.03
R6396:Olfr1225 UTSW 2 89170690 missense probably damaging 0.99
R7103:Olfr1225 UTSW 2 89170483 missense possibly damaging 0.77
R7187:Olfr1225 UTSW 2 89171370 start gained probably benign
R7394:Olfr1225 UTSW 2 89170361 missense probably benign
R7758:Olfr1225 UTSW 2 89171141 missense probably benign 0.00
R8073:Olfr1225 UTSW 2 89170940 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGTATGGAGTGCTCTTAGCC -3'
(R):5'- CCAACAGTGGGTCTATCTGCATC -3'

Sequencing Primer
(F):5'- ATGGAGTGCTCTTAGCCAACAGTC -3'
(R):5'- CAGTGGGTCTATCTGCATCATAATC -3'
Posted On2016-06-21