Incidental Mutation 'R5137:Adh4'
ID396194
Institutional Source Beutler Lab
Gene Symbol Adh4
Ensembl Gene ENSMUSG00000037797
Gene Namealcohol dehydrogenase 4 (class II), pi polypeptide
SynonymsAdh2, mouse class II type ADH
MMRRC Submission 042723-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R5137 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location138415466-138430892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138422235 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 141 (S141P)
Ref Sequence ENSEMBL: ENSMUSP00000013458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013458] [ENSMUST00000161312]
PDB Structure
Mouse class II alcohol dehydrogenase complex with NADH [X-RAY DIFFRACTION]
Mouse class II alcohol dehydrogenase complex with NADH and inhibitor [X-RAY DIFFRACTION]
P47H MUTANT OF MOUSE CLASS II ALCOHOL DEHYDROGENASE COMPLEX WITH NADH [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000013458
AA Change: S141P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000013458
Gene: ENSMUSG00000037797
AA Change: S141P

DomainStartEndE-ValueType
Pfam:ADH_N 34 165 3.1e-23 PFAM
Pfam:ADH_zinc_N 207 337 8.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161312
AA Change: S153P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124163
Gene: ENSMUSG00000037797
AA Change: S153P

DomainStartEndE-ValueType
Pfam:ADH_N 46 177 2.8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162260
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes class II alcohol dehydrogenase 4 pi subunit, which is a member of the alcohol dehydrogenase family. Members of this enzyme family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. Class II alcohol dehydrogenase is a homodimer composed of 2 pi subunits. It exhibits a high activity for oxidation of long-chain aliphatic alcohols and aromatic alcohols and is less sensitive to pyrazole. This gene is localized to chromosome 4 in the cluster of alcohol dehydrogenase genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,069,771 V75A probably benign Het
Ace G C 11: 105,974,826 W628C probably damaging Het
Apob T C 12: 8,011,384 Y3256H possibly damaging Het
B3galnt1 G T 3: 69,574,949 N326K probably benign Het
Catsperb T C 12: 101,549,811 F569L probably damaging Het
Cecr2 A G 6: 120,755,517 I225V probably benign Het
Cox5b A G 1: 36,692,429 probably null Het
Crybg1 T C 10: 43,958,336 D1953G probably damaging Het
Dnaaf5 C T 5: 139,181,460 T707M probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Ebf1 G A 11: 44,991,468 R409Q probably damaging Het
Eef2k G A 7: 120,885,422 A256T probably damaging Het
Eef2k C A 7: 120,885,423 A256D probably damaging Het
Evl C G 12: 108,681,522 T294S probably benign Het
Eya2 T C 2: 165,731,628 Y288H probably damaging Het
Ezh2 A T 6: 47,532,080 probably null Het
Fam171a1 T C 2: 3,225,389 Y395H probably benign Het
Gas2l3 C A 10: 89,413,975 R427L probably damaging Het
Gli2 T A 1: 118,855,503 I91F probably damaging Het
Gm4884 T C 7: 41,042,894 S96P probably damaging Het
Gprc5d T A 6: 135,116,033 D292V probably benign Het
Herc1 A G 9: 66,448,223 K2252R probably benign Het
Il1rl1 A T 1: 40,450,125 M346L probably benign Het
Kcna5 A T 6: 126,533,983 V394D probably damaging Het
Kcng4 A T 8: 119,625,878 M431K possibly damaging Het
Kif1bp A T 10: 62,578,241 V46E probably damaging Het
Large1 A G 8: 73,048,309 F258L possibly damaging Het
Mapkbp1 T A 2: 120,022,181 C1001S probably damaging Het
Micu1 A G 10: 59,827,232 Q328R probably benign Het
Mmp11 G A 10: 75,925,456 P437S probably damaging Het
Msh6 T A 17: 87,980,288 F119I possibly damaging Het
Myo6 A G 9: 80,242,249 E159G probably damaging Het
Negr1 T A 3: 157,016,196 Y136N probably damaging Het
Nol9 T A 4: 152,045,971 C321S probably damaging Het
Nos1 T C 5: 117,905,313 F551S probably benign Het
Nup153 C A 13: 46,684,153 G1198C probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1225 C A 2: 89,170,400 V271F probably benign Het
Olfr395 T C 11: 73,906,626 I289V probably damaging Het
Olfr606 A G 7: 103,451,712 Y125C probably damaging Het
Olfr606 C A 7: 103,451,713 Y125* probably null Het
Omd T C 13: 49,590,076 S201P probably benign Het
Oxct1 G T 15: 4,035,350 A57S probably benign Het
Pcdhga7 T G 18: 37,717,380 S813R probably damaging Het
Pcmtd2 A T 2: 181,854,994 I255F possibly damaging Het
Pdk1 T G 2: 71,883,569 M186R possibly damaging Het
Pelp1 T C 11: 70,395,099 T648A probably damaging Het
Phldb2 A T 16: 45,808,258 S570R possibly damaging Het
Pramef25 T A 4: 143,949,120 T379S probably benign Het
Ptprj T C 2: 90,469,648 T270A possibly damaging Het
Reln C T 5: 21,955,181 G2130D probably damaging Het
Rims1 A T 1: 22,288,620 Y663* probably null Het
Rit2 T C 18: 31,153,764 T123A probably benign Het
Rmdn2 A T 17: 79,667,989 E302D probably benign Het
Ryr1 T C 7: 29,101,858 E827G possibly damaging Het
Siglec1 C T 2: 131,081,344 G494R probably damaging Het
Slc16a14 T A 1: 84,912,597 Y329F probably damaging Het
Slc35d1 A T 4: 103,214,781 L8Q possibly damaging Het
Smpdl3a C T 10: 57,801,067 S57L possibly damaging Het
Snx9 T C 17: 5,928,253 V566A probably damaging Het
Spaca1 A T 4: 34,029,095 I126N probably damaging Het
Spred1 T G 2: 117,163,571 I94S probably damaging Het
Tardbp T C 4: 148,622,037 D105G possibly damaging Het
Tet2 T C 3: 133,476,565 S1213G probably benign Het
Trak1 A T 9: 121,367,055 probably benign Het
Trem3 G A 17: 48,249,728 V76M possibly damaging Het
Ttc13 G T 8: 124,694,935 Y250* probably null Het
Ttll5 T G 12: 85,923,045 S714R possibly damaging Het
Ube2l6 T G 2: 84,802,876 probably null Het
Ubr3 T C 2: 69,973,335 S1090P probably damaging Het
Uhrf1bp1 T G 17: 27,876,990 probably null Het
Vezt T C 10: 93,970,510 T680A probably benign Het
Virma A G 4: 11,546,297 K1762E probably damaging Het
Vps53 A G 11: 76,166,248 S57P probably damaging Het
Vwa7 G T 17: 35,017,846 D130Y probably damaging Het
Vwa8 T G 14: 79,064,902 F1004V probably damaging Het
Zfp35 A T 18: 24,004,137 K513* probably null Het
Zfp384 ACAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGC 6: 125,036,509 probably benign Het
Zfp521 C A 18: 13,845,448 C636F probably damaging Het
Other mutations in Adh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Adh4 APN 3 138420636 missense probably damaging 0.99
IGL01450:Adh4 APN 3 138424033 missense probably benign 0.05
IGL01608:Adh4 APN 3 138429027 unclassified probably benign
IGL01618:Adh4 APN 3 138429027 unclassified probably benign
IGL01621:Adh4 APN 3 138429027 unclassified probably benign
IGL01640:Adh4 APN 3 138429027 unclassified probably benign
IGL01979:Adh4 APN 3 138429027 unclassified probably benign
IGL01982:Adh4 APN 3 138429027 unclassified probably benign
IGL01993:Adh4 APN 3 138429027 unclassified probably benign
IGL02720:Adh4 APN 3 138419220 missense possibly damaging 0.87
IGL03030:Adh4 APN 3 138429145 missense probably benign 0.13
PIT4403001:Adh4 UTSW 3 138424178 missense probably damaging 0.97
R0295:Adh4 UTSW 3 138429076 missense probably damaging 1.00
R0308:Adh4 UTSW 3 138424102 missense probably damaging 1.00
R0636:Adh4 UTSW 3 138428074 missense probably damaging 1.00
R1450:Adh4 UTSW 3 138424174 missense probably damaging 1.00
R4824:Adh4 UTSW 3 138429046 missense possibly damaging 0.81
R5263:Adh4 UTSW 3 138428055 missense probably benign 0.00
R5566:Adh4 UTSW 3 138424189 missense probably damaging 1.00
R6162:Adh4 UTSW 3 138415489 splice site probably null
R7297:Adh4 UTSW 3 138429140 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ACTCAGAAATACTATGTATGGGTGG -3'
(R):5'- GCAGACAGCCTAGCACTTAAGTG -3'

Sequencing Primer
(F):5'- TACTATGTATGGGTGGGAAAAAGATC -3'
(R):5'- CACTTAAGTGTACCTTGGCAGTATTG -3'
Posted On2016-06-21