Mutagenetix > Incidental Mutations

Incidental Mutation 'R5137:Snx9'

396242

Institutional Source

Beutler Lab

Gene Symbol

Snx9

Ensembl Gene

ENSMUSG00000002365

Gene Name

sorting nexin 9

Synonyms

SH3PX1, SDP1

MMRRC Submission

042723-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.751) question?

Stock #

R5137 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

5841329-5931954 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 5928253 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 566 (V566A)

Ref Sequence

ENSEMBL: ENSMUSP00000002436 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002436]

PDB Structure

Solution structure of the SH3 domain from mouse sorting nexin-9 [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000002436
AA Change: V566A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000002436
Gene: ENSMUSG00000002365
AA Change: V566A

Domain	Start	End	E-Value	Type
SH3	3	61	1.51e-16	SMART
low complexity region	84	100	N/A	INTRINSIC
low complexity region	160	170	N/A	INTRINSIC
PX	247	357	4.15e-23	SMART
Pfam:BAR_3_WASP_bdg	358	593	2.4e-120	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phosphoinositide binding domain, and are involved in intracellular trafficking. The encoded protein does not contain a coiled coil region, like some family members, but does contain a SRC homology domain near its N-terminus. The encoded protein is reported to have a variety of interaction partners, including of adaptor protein 2 , dynamin, tyrosine kinase non-receptor 2, Wiskott-Aldrich syndrome-like, and ARP3 actin-related protein 3. The encoded protein is implicated in several stages of intracellular trafficking, including endocytosis, macropinocytosis, and F-actin nucleation. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad9	T	C	3: 36,069,771	V75A	probably benign	Het
Ace	G	C	11: 105,974,826	W628C	probably damaging	Het
Adh4	T	C	3: 138,422,235	S141P	probably benign	Het
Apob	T	C	12: 8,011,384	Y3256H	possibly damaging	Het
B3galnt1	G	T	3: 69,574,949	N326K	probably benign	Het
Catsperb	T	C	12: 101,549,811	F569L	probably damaging	Het
Cecr2	A	G	6: 120,755,517	I225V	probably benign	Het
Cox5b	A	G	1: 36,692,429		probably null	Het
Crybg1	T	C	10: 43,958,336	D1953G	probably damaging	Het
Dnaaf5	C	T	5: 139,181,460	T707M	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Ebf1	G	A	11: 44,991,468	R409Q	probably damaging	Het
Eef2k	G	A	7: 120,885,422	A256T	probably damaging	Het
Eef2k	C	A	7: 120,885,423	A256D	probably damaging	Het
Evl	C	G	12: 108,681,522	T294S	probably benign	Het
Eya2	T	C	2: 165,731,628	Y288H	probably damaging	Het
Ezh2	A	T	6: 47,532,080		probably null	Het
Fam171a1	T	C	2: 3,225,389	Y395H	probably benign	Het
Gas2l3	C	A	10: 89,413,975	R427L	probably damaging	Het
Gli2	T	A	1: 118,855,503	I91F	probably damaging	Het
Gm4884	T	C	7: 41,042,894	S96P	probably damaging	Het
Gprc5d	T	A	6: 135,116,033	D292V	probably benign	Het
Herc1	A	G	9: 66,448,223	K2252R	probably benign	Het
Il1rl1	A	T	1: 40,450,125	M346L	probably benign	Het
Kcna5	A	T	6: 126,533,983	V394D	probably damaging	Het
Kcng4	A	T	8: 119,625,878	M431K	possibly damaging	Het
Kif1bp	A	T	10: 62,578,241	V46E	probably damaging	Het
Large1	A	G	8: 73,048,309	F258L	possibly damaging	Het
Mapkbp1	T	A	2: 120,022,181	C1001S	probably damaging	Het
Micu1	A	G	10: 59,827,232	Q328R	probably benign	Het
Mmp11	G	A	10: 75,925,456	P437S	probably damaging	Het
Msh6	T	A	17: 87,980,288	F119I	possibly damaging	Het
Myo6	A	G	9: 80,242,249	E159G	probably damaging	Het
Negr1	T	A	3: 157,016,196	Y136N	probably damaging	Het
Nol9	T	A	4: 152,045,971	C321S	probably damaging	Het
Nos1	T	C	5: 117,905,313	F551S	probably benign	Het
Nup153	C	A	13: 46,684,153	G1198C	probably damaging	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1225	C	A	2: 89,170,400	V271F	probably benign	Het
Olfr395	T	C	11: 73,906,626	I289V	probably damaging	Het
Olfr606	A	G	7: 103,451,712	Y125C	probably damaging	Het
Olfr606	C	A	7: 103,451,713	Y125*	probably null	Het
Omd	T	C	13: 49,590,076	S201P	probably benign	Het
Oxct1	G	T	15: 4,035,350	A57S	probably benign	Het
Pcdhga7	T	G	18: 37,717,380	S813R	probably damaging	Het
Pcmtd2	A	T	2: 181,854,994	I255F	possibly damaging	Het
Pdk1	T	G	2: 71,883,569	M186R	possibly damaging	Het
Pelp1	T	C	11: 70,395,099	T648A	probably damaging	Het
Phldb2	A	T	16: 45,808,258	S570R	possibly damaging	Het
Pramef25	T	A	4: 143,949,120	T379S	probably benign	Het
Ptprj	T	C	2: 90,469,648	T270A	possibly damaging	Het
Reln	C	T	5: 21,955,181	G2130D	probably damaging	Het
Rims1	A	T	1: 22,288,620	Y663*	probably null	Het
Rit2	T	C	18: 31,153,764	T123A	probably benign	Het
Rmdn2	A	T	17: 79,667,989	E302D	probably benign	Het
Ryr1	T	C	7: 29,101,858	E827G	possibly damaging	Het
Siglec1	C	T	2: 131,081,344	G494R	probably damaging	Het
Slc16a14	T	A	1: 84,912,597	Y329F	probably damaging	Het
Slc35d1	A	T	4: 103,214,781	L8Q	possibly damaging	Het
Smpdl3a	C	T	10: 57,801,067	S57L	possibly damaging	Het
Spaca1	A	T	4: 34,029,095	I126N	probably damaging	Het
Spred1	T	G	2: 117,163,571	I94S	probably damaging	Het
Tardbp	T	C	4: 148,622,037	D105G	possibly damaging	Het
Tet2	T	C	3: 133,476,565	S1213G	probably benign	Het
Trak1	A	T	9: 121,367,055		probably benign	Het
Trem3	G	A	17: 48,249,728	V76M	possibly damaging	Het
Ttc13	G	T	8: 124,694,935	Y250*	probably null	Het
Ttll5	T	G	12: 85,923,045	S714R	possibly damaging	Het
Ube2l6	T	G	2: 84,802,876		probably null	Het
Ubr3	T	C	2: 69,973,335	S1090P	probably damaging	Het
Uhrf1bp1	T	G	17: 27,876,990		probably null	Het
Vezt	T	C	10: 93,970,510	T680A	probably benign	Het
Virma	A	G	4: 11,546,297	K1762E	probably damaging	Het
Vps53	A	G	11: 76,166,248	S57P	probably damaging	Het
Vwa7	G	T	17: 35,017,846	D130Y	probably damaging	Het
Vwa8	T	G	14: 79,064,902	F1004V	probably damaging	Het
Zfp35	A	T	18: 24,004,137	K513*	probably null	Het
Zfp384	ACAGCAGCAGCAGCAGCAGCAGC	ACAGCAGCAGCAGCAGCAGC	6: 125,036,509		probably benign	Het
Zfp521	C	A	18: 13,845,448	C636F	probably damaging	Het

Other mutations in Snx9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Snx9	APN	17	5899361	missense	probably benign
IGL00417:Snx9	APN	17	5891897	missense	probably benign	0.03
IGL01827:Snx9	APN	17	5887012	missense	probably benign	0.04
IGL02531:Snx9	APN	17	5891820	missense	probably benign
IGL02710:Snx9	APN	17	5908598	missense	probably damaging	1.00
IGL03088:Snx9	APN	17	5924610	missense	probably benign
san_angelo	UTSW	17	5891809	nonsense	probably null
PIT4495001:Snx9	UTSW	17	5920126	missense	possibly damaging	0.54
R0555:Snx9	UTSW	17	5918413	missense	probably damaging	0.97
R1015:Snx9	UTSW	17	5920127	missense	probably benign	0.12
R1065:Snx9	UTSW	17	5902361	splice site	probably benign
R1421:Snx9	UTSW	17	5902484	missense	probably benign	0.45
R1657:Snx9	UTSW	17	5918436	missense	possibly damaging	0.65
R1823:Snx9	UTSW	17	5920671	missense	probably damaging	1.00
R1914:Snx9	UTSW	17	5928256	missense	possibly damaging	0.65
R3703:Snx9	UTSW	17	5928200	splice site	probably null
R3871:Snx9	UTSW	17	5891781	missense	probably benign	0.00
R4375:Snx9	UTSW	17	5908626	nonsense	probably null
R4412:Snx9	UTSW	17	5908394	missense	probably damaging	0.96
R4669:Snx9	UTSW	17	5927224	missense	probably damaging	1.00
R4974:Snx9	UTSW	17	5902519	splice site	probably null
R5038:Snx9	UTSW	17	5887073	missense	probably benign	0.12
R5369:Snx9	UTSW	17	5920580	missense	probably damaging	1.00
R5459:Snx9	UTSW	17	5920638	missense	probably damaging	0.99
R5624:Snx9	UTSW	17	5891809	nonsense	probably null
R5847:Snx9	UTSW	17	5924621	missense	possibly damaging	0.94
R5953:Snx9	UTSW	17	5908402	missense	probably damaging	1.00
R5953:Snx9	UTSW	17	5908403	missense	probably damaging	1.00
R6263:Snx9	UTSW	17	5887049	missense	probably damaging	0.98
R6481:Snx9	UTSW	17	5922209	critical splice donor site	probably null
R6491:Snx9	UTSW	17	5920162	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGCCTCTTAGAAGCAGCCAG -3'
(R):5'- TGTTGGGAGGGTACACTCAC -3'

Sequencing Primer
(F):5'- CCAGATGAAGTCCTGCTGATGAC -3'
(R):5'- CTCACACCTGTGGATGGGGATG -3'

Posted On

2016-06-21