Mutagenetix > Incidental Mutations

Incidental Mutation 'R5138:Ino80'

396260

Institutional Source

Beutler Lab

Gene Symbol

Ino80

Ensembl Gene

ENSMUSG00000034154

Gene Name

INO80 complex subunit

Synonyms

INO80, 2310079N15Rik, 4632409L19Rik, Inoc1

MMRRC Submission

042724-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.957) question?

Stock #

R5138 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119373042-119477687 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 119383421 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1223 (T1223A)

Ref Sequence

ENSEMBL: ENSMUSP00000051845 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049920]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049920
AA Change: T1223A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154
AA Change: T1223A

Domain	Start	End	E-Value	Type
coiled coil region	131	165	N/A	INTRINSIC
low complexity region	206	242	N/A	INTRINSIC
Pfam:DBINO	275	407	6.6e-50	PFAM
low complexity region	474	489	N/A	INTRINSIC
DEXDc	516	714	6.27e-37	SMART
low complexity region	907	923	N/A	INTRINSIC
HELICc	1134	1217	2.86e-22	SMART
low complexity region	1270	1324	N/A	INTRINSIC
low complexity region	1357	1368	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1438	1450	N/A	INTRINSIC
low complexity region	1457	1483	N/A	INTRINSIC
low complexity region	1510	1521	N/A	INTRINSIC

Meta Mutation Damage Score

0.3155

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.9%

Validation Efficiency

97% (76/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931429L15Rik	C	A	9: 46,306,821		probably null	Het
Actr10	G	A	12: 70,961,879	G362E	probably damaging	Het
Aldh1a3	T	C	7: 66,407,852	T278A	probably damaging	Het
Arpp21	T	A	9: 112,179,084	K116M	probably damaging	Het
Arrdc3	T	C	13: 80,891,065	Y72H	probably damaging	Het
Atr	T	C	9: 95,937,596	V2212A	probably benign	Het
Bcdin3d	A	G	15: 99,471,051	F89S	possibly damaging	Het
Cacna1d	C	A	14: 30,490,972	A44S	probably benign	Het
Cbx3	A	G	6: 51,475,289	E28G	probably damaging	Het
Cdh23	A	T	10: 60,312,282	F2722L	probably damaging	Het
Clec11a	A	G	7: 44,304,638	V297A	probably benign	Het
Clk2	C	A	3: 89,175,499		probably benign	Het
Clybl	T	A	14: 122,371,304	C103S	possibly damaging	Het
Col12a1	T	A	9: 79,643,966	N2123Y	probably damaging	Het
Corin	G	A	5: 72,339,059	P517L	probably damaging	Het
Ddhd2	A	T	8: 25,727,699	I717N	probably damaging	Het
Derl2	C	A	11: 71,014,564	G31*	probably null	Het
Dgcr8	A	G	16: 18,278,077	V523A	probably damaging	Het
Dnah8	T	C	17: 30,765,597	S3090P	probably damaging	Het
Dsp	C	A	13: 38,183,298	H641N	probably benign	Het
Dsp	A	T	13: 38,195,845	T1590S	possibly damaging	Het
Duox2	A	T	2: 122,297,531	L57Q	probably damaging	Het
Etfdh	A	T	3: 79,623,573	V47D	probably benign	Het
Exoc1	T	C	5: 76,568,075	Y823H	probably damaging	Het
Fam81a	C	T	9: 70,099,175	R185K	probably benign	Het
Fsip2	A	G	2: 82,981,424	I2696V	probably benign	Het
Glis1	GCACACA	GCACA	4: 107,623,105		probably null	Het
Gm15448	A	T	7: 3,824,557	Y200*	probably null	Het
Gtf3c1	A	T	7: 125,647,492	N1548K	probably benign	Het
Hist1h3b	G	A	13: 23,752,630	R84H	probably damaging	Het
Hkdc1	A	T	10: 62,398,691	I575N	probably damaging	Het
Ifi208	A	G	1: 173,690,673	I449V	probably null	Het
Kctd9	T	C	14: 67,728,748		probably null	Het
Khdrbs1	A	G	4: 129,741,854	Y103H	probably benign	Het
Kmt2e	A	G	5: 23,502,695	H1752R	probably damaging	Het
Lrp5	T	A	19: 3,628,319	Q512L	probably benign	Het
Map2k5	T	C	9: 63,263,158	T293A	probably damaging	Het
Myo7a	C	A	7: 98,083,599	R657L	probably damaging	Het
Myrfl	A	G	10: 116,796,058		probably null	Het
Nfatc2	G	A	2: 168,536,309	H258Y	probably damaging	Het
Nup205	T	A	6: 35,225,866	L1336Q	probably damaging	Het
Olfr1218	T	C	2: 89,054,947	I160V	probably benign	Het
Olfr1436	T	C	19: 12,298,776	M119V	possibly damaging	Het
Olfr419	A	G	1: 174,250,829	S33P	probably damaging	Het
Otog	T	A	7: 46,250,006	S244T	possibly damaging	Het
Pcdh17	T	G	14: 84,447,209	I372S	probably damaging	Het
Plagl1	A	G	10: 13,128,175		probably benign	Het
Pnpla7	T	C	2: 25,041,103	F910S	possibly damaging	Het
Prdm13	G	A	4: 21,679,507	P328S	unknown	Het
Prdm5	C	T	6: 65,856,102	Q152*	probably null	Het
Psat1	A	G	19: 15,914,948	F216S	possibly damaging	Het
Psg21	A	T	7: 18,656,528	M1K	probably null	Het
Rab11fip3	A	T	17: 25,991,026	S994T	probably benign	Het
Rax	A	G	18: 65,938,318		probably benign	Het
Rgs22	A	T	15: 36,099,788	S260R	probably benign	Het
Ryr2	A	T	13: 11,660,289	H3317Q	probably damaging	Het
Sc5d	A	G	9: 42,255,515	Y243H	probably damaging	Het
Serpinf1	T	C	11: 75,415,028	E178G	probably damaging	Het
Slc15a3	A	T	19: 10,856,005	Y462F	probably damaging	Het
Slc9b1	G	A	3: 135,357,773		probably benign	Het
Slit2	C	T	5: 48,281,967	P1111S	probably damaging	Het
Slit3	T	C	11: 35,588,985	Y330H	probably damaging	Het
Snw1	T	C	12: 87,460,435	K204E	probably benign	Het
Steap1	A	G	5: 5,736,486	I317T	probably damaging	Het
Sval2	A	G	6: 41,861,945	N20S	probably damaging	Het
Tfrc	C	A	16: 32,615,209	Y85*	probably null	Het
Tmem87a	T	C	2: 120,371,545	T412A	possibly damaging	Het
Utp20	T	C	10: 88,747,377	K2705E	probably damaging	Het
Vmn1r230	A	T	17: 20,846,968	K140*	probably null	Het
Vmn2r62	A	T	7: 42,764,816	H734Q	possibly damaging	Het
Zbtb8os	T	A	4: 129,346,926		probably benign	Het
Zfp608	A	T	18: 54,891,799	H1466Q	probably damaging	Het
Zfp957	C	T	14: 79,212,922	C479Y	probably damaging	Het

Other mutations in Ino80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01404:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01985:Ino80	APN	2	119433321	missense	probably damaging	0.99
IGL02039:Ino80	APN	2	119380073	missense	probably damaging	1.00
IGL02187:Ino80	APN	2	119445457	splice site	probably benign
IGL02726:Ino80	APN	2	119442483	missense	probably damaging	1.00
chosen	UTSW	2	119382269	splice site	probably null
PIT4677001:Ino80	UTSW	2	119377545	missense	probably benign
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0057:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0113:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0114:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0115:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0138:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0189:Ino80	UTSW	2	119379679	missense	probably benign	0.36
R0363:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0364:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0365:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0481:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0532:Ino80	UTSW	2	119381983	missense	possibly damaging	0.79
R0580:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R0610:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0675:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R1275:Ino80	UTSW	2	119427055	missense	probably benign	0.12
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1506:Ino80	UTSW	2	119425265	nonsense	probably null
R1510:Ino80	UTSW	2	119450049	missense	probably damaging	1.00
R1570:Ino80	UTSW	2	119447028	missense	possibly damaging	0.68
R1613:Ino80	UTSW	2	119392867	missense	probably damaging	1.00
R1673:Ino80	UTSW	2	119381936	missense	probably damaging	1.00
R1773:Ino80	UTSW	2	119418409	missense	probably benign	0.18
R1795:Ino80	UTSW	2	119406859	missense	probably damaging	1.00
R2093:Ino80	UTSW	2	119426670	missense	possibly damaging	0.55
R2105:Ino80	UTSW	2	119431929	missense	probably null	1.00
R2113:Ino80	UTSW	2	119454084	missense	probably damaging	1.00
R3618:Ino80	UTSW	2	119446872	missense	probably null	0.81
R4572:Ino80	UTSW	2	119402358	missense	probably damaging	1.00
R4649:Ino80	UTSW	2	119431008	missense	probably damaging	1.00
R4919:Ino80	UTSW	2	119442592	missense	probably damaging	1.00
R5113:Ino80	UTSW	2	119431945	missense	probably damaging	1.00
R5458:Ino80	UTSW	2	119412429	missense	possibly damaging	0.50
R5499:Ino80	UTSW	2	119441647	missense	probably damaging	1.00
R5502:Ino80	UTSW	2	119402396	missense	probably damaging	1.00
R5531:Ino80	UTSW	2	119445575	missense	probably benign
R5740:Ino80	UTSW	2	119431029	missense	probably damaging	1.00
R5892:Ino80	UTSW	2	119439547	intron	probably benign
R5914:Ino80	UTSW	2	119458216	missense	probably damaging	0.99
R6000:Ino80	UTSW	2	119374508	missense	probably benign	0.04
R6263:Ino80	UTSW	2	119383414	missense	probably damaging	1.00
R6505:Ino80	UTSW	2	119451441	missense	probably damaging	1.00
R6942:Ino80	UTSW	2	119383502	missense	probably damaging	0.99
R7052:Ino80	UTSW	2	119426587	critical splice donor site	probably null
R7100:Ino80	UTSW	2	119374513	missense	possibly damaging	0.47
R7163:Ino80	UTSW	2	119392875	missense	probably damaging	1.00
R7187:Ino80	UTSW	2	119426591	missense	probably benign	0.00
R7202:Ino80	UTSW	2	119374437	missense	probably benign	0.00
R7218:Ino80	UTSW	2	119458127	missense	probably benign
R7389:Ino80	UTSW	2	119442529	missense	probably benign	0.00
R7419:Ino80	UTSW	2	119380014	missense	probably benign	0.00
R7437:Ino80	UTSW	2	119442586	missense	possibly damaging	0.86
R7607:Ino80	UTSW	2	119382269	splice site	probably null
R7702:Ino80	UTSW	2	119442573	missense	probably benign	0.01
R7975:Ino80	UTSW	2	119456467	splice site	probably null
R7978:Ino80	UTSW	2	119439393	missense	possibly damaging	0.93
R8376:Ino80	UTSW	2	119442487	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- CCTGGTATCAGTGTACACAGGAG -3'
(R):5'- AGATAAGTGGCTATACTGCTCTCAG -3'

Sequencing Primer
(F):5'- GTAAGGTACAGGCTCCAATGCTTAC -3'
(R):5'- AGAATTTCTGTCCTGCACTCAGAAC -3'

Posted On

2016-06-21