Incidental Mutation 'R5138:Kmt2e'
ID396271
Institutional Source Beutler Lab
Gene Symbol Kmt2e
Ensembl Gene ENSMUSG00000029004
Gene Namelysine (K)-specific methyltransferase 2E
SynonymsD230038D11Rik, 9530077A04Rik, 1810033J14Rik, Mll5
MMRRC Submission 042724-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5138 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location23434441-23504235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23502695 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 1752 (H1752R)
Ref Sequence ENSEMBL: ENSMUSP00000110781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088392] [ENSMUST00000094962] [ENSMUST00000115128] [ENSMUST00000126586] [ENSMUST00000196260] [ENSMUST00000196929]
Predicted Effect probably benign
Transcript: ENSMUST00000088392
SMART Domains Protein: ENSMUSP00000085734
Gene: ENSMUSG00000062604

DomainStartEndE-ValueType
low complexity region 5 46 N/A INTRINSIC
Pfam:Pkinase 79 228 1.3e-22 PFAM
Pfam:Pkinase_Tyr 79 228 1e-9 PFAM
coiled coil region 263 314 N/A INTRINSIC
coiled coil region 339 373 N/A INTRINSIC
low complexity region 393 406 N/A INTRINSIC
Pfam:Pkinase 506 680 1.9e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094962
AA Change: H1752R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092569
Gene: ENSMUSG00000029004
AA Change: H1752R

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000115128
AA Change: H1752R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110781
Gene: ENSMUSG00000029004
AA Change: H1752R

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000126586
Predicted Effect probably benign
Transcript: ENSMUST00000194010
Predicted Effect probably benign
Transcript: ENSMUST00000196260
SMART Domains Protein: ENSMUSP00000143791
Gene: ENSMUSG00000029004

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196929
SMART Domains Protein: ENSMUSP00000143216
Gene: ENSMUSG00000062604

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 131 2.6e-8 PFAM
Pfam:Pkinase 2 130 2.3e-18 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a protein with an N-terminal PHD zinc finger and a central SET domain. Overexpression of the protein inhibits cell cycle progression. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal and postnatal lethality, reduced fertility and growth, and abnormal lymphopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik C A 9: 46,306,821 probably null Het
Actr10 G A 12: 70,961,879 G362E probably damaging Het
Aldh1a3 T C 7: 66,407,852 T278A probably damaging Het
Arpp21 T A 9: 112,179,084 K116M probably damaging Het
Arrdc3 T C 13: 80,891,065 Y72H probably damaging Het
Atr T C 9: 95,937,596 V2212A probably benign Het
Bcdin3d A G 15: 99,471,051 F89S possibly damaging Het
Cacna1d C A 14: 30,490,972 A44S probably benign Het
Cbx3 A G 6: 51,475,289 E28G probably damaging Het
Cdh23 A T 10: 60,312,282 F2722L probably damaging Het
Clec11a A G 7: 44,304,638 V297A probably benign Het
Clk2 C A 3: 89,175,499 probably benign Het
Clybl T A 14: 122,371,304 C103S possibly damaging Het
Col12a1 T A 9: 79,643,966 N2123Y probably damaging Het
Corin G A 5: 72,339,059 P517L probably damaging Het
Ddhd2 A T 8: 25,727,699 I717N probably damaging Het
Derl2 C A 11: 71,014,564 G31* probably null Het
Dgcr8 A G 16: 18,278,077 V523A probably damaging Het
Dnah8 T C 17: 30,765,597 S3090P probably damaging Het
Dsp A T 13: 38,195,845 T1590S possibly damaging Het
Dsp C A 13: 38,183,298 H641N probably benign Het
Duox2 A T 2: 122,297,531 L57Q probably damaging Het
Etfdh A T 3: 79,623,573 V47D probably benign Het
Exoc1 T C 5: 76,568,075 Y823H probably damaging Het
Fam81a C T 9: 70,099,175 R185K probably benign Het
Fsip2 A G 2: 82,981,424 I2696V probably benign Het
Glis1 GCACACA GCACA 4: 107,623,105 probably null Het
Gm15448 A T 7: 3,824,557 Y200* probably null Het
Gtf3c1 A T 7: 125,647,492 N1548K probably benign Het
Hist1h3b G A 13: 23,752,630 R84H probably damaging Het
Hkdc1 A T 10: 62,398,691 I575N probably damaging Het
Ifi208 A G 1: 173,690,673 I449V probably null Het
Ino80 T C 2: 119,383,421 T1223A probably damaging Het
Kctd9 T C 14: 67,728,748 probably null Het
Khdrbs1 A G 4: 129,741,854 Y103H probably benign Het
Lrp5 T A 19: 3,628,319 Q512L probably benign Het
Map2k5 T C 9: 63,263,158 T293A probably damaging Het
Myo7a C A 7: 98,083,599 R657L probably damaging Het
Myrfl A G 10: 116,796,058 probably null Het
Nfatc2 G A 2: 168,536,309 H258Y probably damaging Het
Nup205 T A 6: 35,225,866 L1336Q probably damaging Het
Olfr1218 T C 2: 89,054,947 I160V probably benign Het
Olfr1436 T C 19: 12,298,776 M119V possibly damaging Het
Olfr419 A G 1: 174,250,829 S33P probably damaging Het
Otog T A 7: 46,250,006 S244T possibly damaging Het
Pcdh17 T G 14: 84,447,209 I372S probably damaging Het
Plagl1 A G 10: 13,128,175 probably benign Het
Pnpla7 T C 2: 25,041,103 F910S possibly damaging Het
Prdm13 G A 4: 21,679,507 P328S unknown Het
Prdm5 C T 6: 65,856,102 Q152* probably null Het
Psat1 A G 19: 15,914,948 F216S possibly damaging Het
Psg21 A T 7: 18,656,528 M1K probably null Het
Rab11fip3 A T 17: 25,991,026 S994T probably benign Het
Rax A G 18: 65,938,318 probably benign Het
Rgs22 A T 15: 36,099,788 S260R probably benign Het
Ryr2 A T 13: 11,660,289 H3317Q probably damaging Het
Sc5d A G 9: 42,255,515 Y243H probably damaging Het
Serpinf1 T C 11: 75,415,028 E178G probably damaging Het
Slc15a3 A T 19: 10,856,005 Y462F probably damaging Het
Slc9b1 G A 3: 135,357,773 probably benign Het
Slit2 C T 5: 48,281,967 P1111S probably damaging Het
Slit3 T C 11: 35,588,985 Y330H probably damaging Het
Snw1 T C 12: 87,460,435 K204E probably benign Het
Steap1 A G 5: 5,736,486 I317T probably damaging Het
Sval2 A G 6: 41,861,945 N20S probably damaging Het
Tfrc C A 16: 32,615,209 Y85* probably null Het
Tmem87a T C 2: 120,371,545 T412A possibly damaging Het
Utp20 T C 10: 88,747,377 K2705E probably damaging Het
Vmn1r230 A T 17: 20,846,968 K140* probably null Het
Vmn2r62 A T 7: 42,764,816 H734Q possibly damaging Het
Zbtb8os T A 4: 129,346,926 probably benign Het
Zfp608 A T 18: 54,891,799 H1466Q probably damaging Het
Zfp957 C T 14: 79,212,922 C479Y probably damaging Het
Other mutations in Kmt2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Kmt2e APN 5 23492358 missense probably damaging 0.99
IGL01330:Kmt2e APN 5 23497948 missense possibly damaging 0.95
IGL01457:Kmt2e APN 5 23502019 missense possibly damaging 0.62
IGL01691:Kmt2e APN 5 23497091 missense probably benign
IGL02274:Kmt2e APN 5 23500760 missense probably benign 0.00
IGL02934:Kmt2e APN 5 23497884 missense probably damaging 0.97
IGL02964:Kmt2e APN 5 23467100 splice site probably benign
IGL03011:Kmt2e APN 5 23497542 missense probably damaging 1.00
IGL03291:Kmt2e APN 5 23499291 missense probably damaging 1.00
R0035:Kmt2e UTSW 5 23485621 splice site probably benign
R0446:Kmt2e UTSW 5 23497534 splice site probably null
R0498:Kmt2e UTSW 5 23478972 nonsense probably null
R0699:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0701:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0761:Kmt2e UTSW 5 23503034 nonsense probably null
R1110:Kmt2e UTSW 5 23502655 missense probably damaging 1.00
R1295:Kmt2e UTSW 5 23502404 missense probably damaging 0.99
R1432:Kmt2e UTSW 5 23450321 missense probably benign 0.39
R1495:Kmt2e UTSW 5 23499327 missense possibly damaging 0.83
R1505:Kmt2e UTSW 5 23500535 missense probably null 0.01
R1623:Kmt2e UTSW 5 23482502 missense probably damaging 1.00
R1675:Kmt2e UTSW 5 23482453 nonsense probably null
R1691:Kmt2e UTSW 5 23464849 missense probably damaging 1.00
R1778:Kmt2e UTSW 5 23492364 missense probably damaging 1.00
R1820:Kmt2e UTSW 5 23473547 missense probably damaging 1.00
R1846:Kmt2e UTSW 5 23499486 intron probably benign
R1912:Kmt2e UTSW 5 23492395 missense probably benign 0.07
R2070:Kmt2e UTSW 5 23501995 missense probably benign
R2195:Kmt2e UTSW 5 23502196 unclassified probably null
R2571:Kmt2e UTSW 5 23501887 missense probably benign 0.08
R3901:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3902:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3905:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3906:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3909:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3956:Kmt2e UTSW 5 23496025 missense probably benign 0.00
R4242:Kmt2e UTSW 5 23502822 unclassified probably benign
R4299:Kmt2e UTSW 5 23464914 missense probably damaging 1.00
R4448:Kmt2e UTSW 5 23464790 missense possibly damaging 0.80
R4528:Kmt2e UTSW 5 23473558 missense possibly damaging 0.69
R4574:Kmt2e UTSW 5 23492407 missense possibly damaging 0.60
R4719:Kmt2e UTSW 5 23492315 missense probably damaging 1.00
R4754:Kmt2e UTSW 5 23482441 missense possibly damaging 0.88
R4787:Kmt2e UTSW 5 23463083 missense possibly damaging 0.65
R4812:Kmt2e UTSW 5 23502587 missense possibly damaging 0.86
R4853:Kmt2e UTSW 5 23502341 missense probably damaging 1.00
R5306:Kmt2e UTSW 5 23499333 missense probably damaging 0.98
R5659:Kmt2e UTSW 5 23497807 missense probably damaging 0.99
R5907:Kmt2e UTSW 5 23464706 missense probably damaging 1.00
R5920:Kmt2e UTSW 5 23499442 missense possibly damaging 0.50
R6280:Kmt2e UTSW 5 23499516 missense possibly damaging 0.48
R6353:Kmt2e UTSW 5 23493245 missense probably damaging 1.00
R6375:Kmt2e UTSW 5 23499519 missense probably benign
R6553:Kmt2e UTSW 5 23463026 missense probably damaging 0.99
R6572:Kmt2e UTSW 5 23497581 missense possibly damaging 0.66
R6678:Kmt2e UTSW 5 23499295 missense possibly damaging 0.54
R6791:Kmt2e UTSW 5 23499476 intron probably benign
R6792:Kmt2e UTSW 5 23499476 intron probably benign
R6794:Kmt2e UTSW 5 23499476 intron probably benign
R6797:Kmt2e UTSW 5 23482507 missense possibly damaging 0.82
R6947:Kmt2e UTSW 5 23497545 missense probably damaging 1.00
R7023:Kmt2e UTSW 5 23500487 missense possibly damaging 0.46
R7036:Kmt2e UTSW 5 23478743 missense probably null 1.00
R7173:Kmt2e UTSW 5 23464857 missense probably damaging 1.00
R7202:Kmt2e UTSW 5 23492294 unclassified probably benign
R7563:Kmt2e UTSW 5 23500273 missense probably damaging 1.00
R7571:Kmt2e UTSW 5 23478587 missense probably damaging 1.00
R7604:Kmt2e UTSW 5 23501765 missense not run
R7722:Kmt2e UTSW 5 23497018 missense probably benign 0.00
R7758:Kmt2e UTSW 5 23496070 missense possibly damaging 0.92
R7794:Kmt2e UTSW 5 23464716 missense probably damaging 1.00
RF019:Kmt2e UTSW 5 23499494 intron probably benign
RF026:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF028:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF040:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF042:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
Z1177:Kmt2e UTSW 5 23481208 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGCAGGACACCATTTACCAC -3'
(R):5'- CAGAACCCTGAAGCAGTAGG -3'

Sequencing Primer
(F):5'- GGTCCTGCCCCACATCAC -3'
(R):5'- CCCTGAAGCAGTAGGGGTTG -3'
Posted On2016-06-21