Incidental Mutation 'R5138:Cbx3'
ID396277
Institutional Source Beutler Lab
Gene Symbol Cbx3
Ensembl Gene ENSMUSG00000029836
Gene Namechromobox 3
Synonymsheterochromatin protein 1 gamma, M32, HP1g
MMRRC Submission 042724-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.609) question?
Stock #R5138 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location51470360-51483704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51475289 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 28 (E28G)
Ref Sequence ENSEMBL: ENSMUSP00000121370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031862] [ENSMUST00000094623] [ENSMUST00000114445] [ENSMUST00000114446] [ENSMUST00000141711]
Predicted Effect probably damaging
Transcript: ENSMUST00000031862
AA Change: E28G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031862
Gene: ENSMUSG00000029836
AA Change: E28G

DomainStartEndE-ValueType
CHROMO 29 81 2.03e-17 SMART
low complexity region 90 113 N/A INTRINSIC
ChSh 115 177 6.46e-34 SMART
CHROMO 120 172 5.92e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094623
AA Change: E28G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110091
Gene: ENSMUSG00000029836
AA Change: E28G

DomainStartEndE-ValueType
CHROMO 29 81 2.03e-17 SMART
low complexity region 90 113 N/A INTRINSIC
ChSh 115 177 6.46e-34 SMART
CHROMO 120 172 5.92e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114445
AA Change: E28G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110088
Gene: ENSMUSG00000029836
AA Change: E28G

DomainStartEndE-ValueType
Pfam:Chromo 30 60 1.4e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114446
AA Change: E28G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110089
Gene: ENSMUSG00000029836
AA Change: E28G

DomainStartEndE-ValueType
CHROMO 29 81 2.03e-17 SMART
low complexity region 90 113 N/A INTRINSIC
ChSh 115 177 6.46e-34 SMART
CHROMO 120 172 5.92e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000141711
AA Change: E28G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000121370
Gene: ENSMUSG00000029836
AA Change: E28G

DomainStartEndE-ValueType
CHROMO 29 81 2.03e-17 SMART
low complexity region 90 109 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203404
Meta Mutation Damage Score 0.2391 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] At the nuclear envelope, the nuclear lamina and heterochromatin are adjacent to the inner nuclear membrane. The protein encoded by this gene binds DNA and is a component of heterochromatin. This protein also can bind lamin B receptor, an integral membrane protein found in the inner nuclear membrane. The dual binding functions of the encoded protein may explain the association of heterochromatin with the inner nuclear membrane. This protein binds histone H3 tails methylated at Lys-9 sites. This protein is also recruited to sites of ultraviolet-induced DNA damage and double-strand breaks. Two transcript variants encoding the same protein but differing in the 5' UTR, have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a gene trap allele are infertile. Mice homozygous for a hypomorphic targeted allele exhibit partial postnatal lethality and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik C A 9: 46,306,821 probably null Het
Actr10 G A 12: 70,961,879 G362E probably damaging Het
Aldh1a3 T C 7: 66,407,852 T278A probably damaging Het
Arpp21 T A 9: 112,179,084 K116M probably damaging Het
Arrdc3 T C 13: 80,891,065 Y72H probably damaging Het
Atr T C 9: 95,937,596 V2212A probably benign Het
Bcdin3d A G 15: 99,471,051 F89S possibly damaging Het
Cacna1d C A 14: 30,490,972 A44S probably benign Het
Cdh23 A T 10: 60,312,282 F2722L probably damaging Het
Clec11a A G 7: 44,304,638 V297A probably benign Het
Clk2 C A 3: 89,175,499 probably benign Het
Clybl T A 14: 122,371,304 C103S possibly damaging Het
Col12a1 T A 9: 79,643,966 N2123Y probably damaging Het
Corin G A 5: 72,339,059 P517L probably damaging Het
Ddhd2 A T 8: 25,727,699 I717N probably damaging Het
Derl2 C A 11: 71,014,564 G31* probably null Het
Dgcr8 A G 16: 18,278,077 V523A probably damaging Het
Dnah8 T C 17: 30,765,597 S3090P probably damaging Het
Dsp C A 13: 38,183,298 H641N probably benign Het
Dsp A T 13: 38,195,845 T1590S possibly damaging Het
Duox2 A T 2: 122,297,531 L57Q probably damaging Het
Etfdh A T 3: 79,623,573 V47D probably benign Het
Exoc1 T C 5: 76,568,075 Y823H probably damaging Het
Fam81a C T 9: 70,099,175 R185K probably benign Het
Fsip2 A G 2: 82,981,424 I2696V probably benign Het
Glis1 GCACACA GCACA 4: 107,623,105 probably null Het
Gm15448 A T 7: 3,824,557 Y200* probably null Het
Gtf3c1 A T 7: 125,647,492 N1548K probably benign Het
Hist1h3b G A 13: 23,752,630 R84H probably damaging Het
Hkdc1 A T 10: 62,398,691 I575N probably damaging Het
Ifi208 A G 1: 173,690,673 I449V probably null Het
Ino80 T C 2: 119,383,421 T1223A probably damaging Het
Kctd9 T C 14: 67,728,748 probably null Het
Khdrbs1 A G 4: 129,741,854 Y103H probably benign Het
Kmt2e A G 5: 23,502,695 H1752R probably damaging Het
Lrp5 T A 19: 3,628,319 Q512L probably benign Het
Map2k5 T C 9: 63,263,158 T293A probably damaging Het
Myo7a C A 7: 98,083,599 R657L probably damaging Het
Myrfl A G 10: 116,796,058 probably null Het
Nfatc2 G A 2: 168,536,309 H258Y probably damaging Het
Nup205 T A 6: 35,225,866 L1336Q probably damaging Het
Olfr1218 T C 2: 89,054,947 I160V probably benign Het
Olfr1436 T C 19: 12,298,776 M119V possibly damaging Het
Olfr419 A G 1: 174,250,829 S33P probably damaging Het
Otog T A 7: 46,250,006 S244T possibly damaging Het
Pcdh17 T G 14: 84,447,209 I372S probably damaging Het
Plagl1 A G 10: 13,128,175 probably benign Het
Pnpla7 T C 2: 25,041,103 F910S possibly damaging Het
Prdm13 G A 4: 21,679,507 P328S unknown Het
Prdm5 C T 6: 65,856,102 Q152* probably null Het
Psat1 A G 19: 15,914,948 F216S possibly damaging Het
Psg21 A T 7: 18,656,528 M1K probably null Het
Rab11fip3 A T 17: 25,991,026 S994T probably benign Het
Rax A G 18: 65,938,318 probably benign Het
Rgs22 A T 15: 36,099,788 S260R probably benign Het
Ryr2 A T 13: 11,660,289 H3317Q probably damaging Het
Sc5d A G 9: 42,255,515 Y243H probably damaging Het
Serpinf1 T C 11: 75,415,028 E178G probably damaging Het
Slc15a3 A T 19: 10,856,005 Y462F probably damaging Het
Slc9b1 G A 3: 135,357,773 probably benign Het
Slit2 C T 5: 48,281,967 P1111S probably damaging Het
Slit3 T C 11: 35,588,985 Y330H probably damaging Het
Snw1 T C 12: 87,460,435 K204E probably benign Het
Steap1 A G 5: 5,736,486 I317T probably damaging Het
Sval2 A G 6: 41,861,945 N20S probably damaging Het
Tfrc C A 16: 32,615,209 Y85* probably null Het
Tmem87a T C 2: 120,371,545 T412A possibly damaging Het
Utp20 T C 10: 88,747,377 K2705E probably damaging Het
Vmn1r230 A T 17: 20,846,968 K140* probably null Het
Vmn2r62 A T 7: 42,764,816 H734Q possibly damaging Het
Zbtb8os T A 4: 129,346,926 probably benign Het
Zfp608 A T 18: 54,891,799 H1466Q probably damaging Het
Zfp957 C T 14: 79,212,922 C479Y probably damaging Het
Other mutations in Cbx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Cbx3 APN 6 51475301 missense probably damaging 0.97
R2037:Cbx3 UTSW 6 51471813 splice site probably null
R4877:Cbx3 UTSW 6 51482560 missense possibly damaging 0.59
R5518:Cbx3 UTSW 6 51481746 missense probably benign 0.12
R7350:Cbx3 UTSW 6 51475375 critical splice donor site probably null
R7465:Cbx3 UTSW 6 51478530 missense probably benign 0.00
X0020:Cbx3 UTSW 6 51481752 missense probably benign 0.20
X0025:Cbx3 UTSW 6 51482515 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GCTTACACTGGATCAAGGAAGTT -3'
(R):5'- AGCACCGTTAAAGGTACTAACTT -3'

Sequencing Primer
(F):5'- TACACTGGATCAAGGAAGTTTAAAG -3'
(R):5'- ACTCACTTTAGTAGACCAGGCTGG -3'
Posted On2016-06-21