Mutagenetix > Incidental Mutations

Incidental Mutation 'R5138:Map2k5'

396290

Institutional Source

Beutler Lab

Gene Symbol

Map2k5

Ensembl Gene

ENSMUSG00000058444

Gene Name

mitogen-activated protein kinase kinase 5

Synonyms

MEK5

MMRRC Submission

042724-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5138 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63163768-63377902 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 63263158 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 293 (T293A)

Ref Sequence

ENSEMBL: ENSMUSP00000034920 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034920]

PDB Structure

Solution structure of the PB1 domain of mouse mitogen activated protein kinase kinase 5 (MAP2K5) [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034920
AA Change: T293A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000034920
Gene: ENSMUSG00000058444
AA Change: T293A

Domain	Start	End	E-Value	Type
PB1	18	97	7.59e-12	SMART
S_TKc	166	419	7.75e-71	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213604

Meta Mutation Damage Score

0.8404

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.9%

Validation Efficiency

97% (76/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically interacts with and activates MAPK7/ERK5. This kinase itself can be phosphorylated and activated by MAP3K3/MEKK3, as well as by atypical protein kinase C isoforms (aPKCs). The signal cascade mediated by this kinase is involved in growth factor stimulated cell proliferation and muscle cell differentiation. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been described. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous mutants die at E10.5 and exhibit abnormal cardiac development and a decrease in proliferation and an increase in apoptosis in the heart, head, and dorsal regions of the embryo. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931429L15Rik	C	A	9: 46,306,821		probably null	Het
Actr10	G	A	12: 70,961,879	G362E	probably damaging	Het
Aldh1a3	T	C	7: 66,407,852	T278A	probably damaging	Het
Arpp21	T	A	9: 112,179,084	K116M	probably damaging	Het
Arrdc3	T	C	13: 80,891,065	Y72H	probably damaging	Het
Atr	T	C	9: 95,937,596	V2212A	probably benign	Het
Bcdin3d	A	G	15: 99,471,051	F89S	possibly damaging	Het
Cacna1d	C	A	14: 30,490,972	A44S	probably benign	Het
Cbx3	A	G	6: 51,475,289	E28G	probably damaging	Het
Cdh23	A	T	10: 60,312,282	F2722L	probably damaging	Het
Clec11a	A	G	7: 44,304,638	V297A	probably benign	Het
Clk2	C	A	3: 89,175,499		probably benign	Het
Clybl	T	A	14: 122,371,304	C103S	possibly damaging	Het
Col12a1	T	A	9: 79,643,966	N2123Y	probably damaging	Het
Corin	G	A	5: 72,339,059	P517L	probably damaging	Het
Ddhd2	A	T	8: 25,727,699	I717N	probably damaging	Het
Derl2	C	A	11: 71,014,564	G31*	probably null	Het
Dgcr8	A	G	16: 18,278,077	V523A	probably damaging	Het
Dnah8	T	C	17: 30,765,597	S3090P	probably damaging	Het
Dsp	C	A	13: 38,183,298	H641N	probably benign	Het
Dsp	A	T	13: 38,195,845	T1590S	possibly damaging	Het
Duox2	A	T	2: 122,297,531	L57Q	probably damaging	Het
Etfdh	A	T	3: 79,623,573	V47D	probably benign	Het
Exoc1	T	C	5: 76,568,075	Y823H	probably damaging	Het
Fam81a	C	T	9: 70,099,175	R185K	probably benign	Het
Fsip2	A	G	2: 82,981,424	I2696V	probably benign	Het
Glis1	GCACACA	GCACA	4: 107,623,105		probably null	Het
Gm15448	A	T	7: 3,824,557	Y200*	probably null	Het
Gtf3c1	A	T	7: 125,647,492	N1548K	probably benign	Het
Hist1h3b	G	A	13: 23,752,630	R84H	probably damaging	Het
Hkdc1	A	T	10: 62,398,691	I575N	probably damaging	Het
Ifi208	A	G	1: 173,690,673	I449V	probably null	Het
Ino80	T	C	2: 119,383,421	T1223A	probably damaging	Het
Kctd9	T	C	14: 67,728,748		probably null	Het
Khdrbs1	A	G	4: 129,741,854	Y103H	probably benign	Het
Kmt2e	A	G	5: 23,502,695	H1752R	probably damaging	Het
Lrp5	T	A	19: 3,628,319	Q512L	probably benign	Het
Myo7a	C	A	7: 98,083,599	R657L	probably damaging	Het
Myrfl	A	G	10: 116,796,058		probably null	Het
Nfatc2	G	A	2: 168,536,309	H258Y	probably damaging	Het
Nup205	T	A	6: 35,225,866	L1336Q	probably damaging	Het
Olfr1218	T	C	2: 89,054,947	I160V	probably benign	Het
Olfr1436	T	C	19: 12,298,776	M119V	possibly damaging	Het
Olfr419	A	G	1: 174,250,829	S33P	probably damaging	Het
Otog	T	A	7: 46,250,006	S244T	possibly damaging	Het
Pcdh17	T	G	14: 84,447,209	I372S	probably damaging	Het
Plagl1	A	G	10: 13,128,175		probably benign	Het
Pnpla7	T	C	2: 25,041,103	F910S	possibly damaging	Het
Prdm13	G	A	4: 21,679,507	P328S	unknown	Het
Prdm5	C	T	6: 65,856,102	Q152*	probably null	Het
Psat1	A	G	19: 15,914,948	F216S	possibly damaging	Het
Psg21	A	T	7: 18,656,528	M1K	probably null	Het
Rab11fip3	A	T	17: 25,991,026	S994T	probably benign	Het
Rax	A	G	18: 65,938,318		probably benign	Het
Rgs22	A	T	15: 36,099,788	S260R	probably benign	Het
Ryr2	A	T	13: 11,660,289	H3317Q	probably damaging	Het
Sc5d	A	G	9: 42,255,515	Y243H	probably damaging	Het
Serpinf1	T	C	11: 75,415,028	E178G	probably damaging	Het
Slc15a3	A	T	19: 10,856,005	Y462F	probably damaging	Het
Slc9b1	G	A	3: 135,357,773		probably benign	Het
Slit2	C	T	5: 48,281,967	P1111S	probably damaging	Het
Slit3	T	C	11: 35,588,985	Y330H	probably damaging	Het
Snw1	T	C	12: 87,460,435	K204E	probably benign	Het
Steap1	A	G	5: 5,736,486	I317T	probably damaging	Het
Sval2	A	G	6: 41,861,945	N20S	probably damaging	Het
Tfrc	C	A	16: 32,615,209	Y85*	probably null	Het
Tmem87a	T	C	2: 120,371,545	T412A	possibly damaging	Het
Utp20	T	C	10: 88,747,377	K2705E	probably damaging	Het
Vmn1r230	A	T	17: 20,846,968	K140*	probably null	Het
Vmn2r62	A	T	7: 42,764,816	H734Q	possibly damaging	Het
Zbtb8os	T	A	4: 129,346,926		probably benign	Het
Zfp608	A	T	18: 54,891,799	H1466Q	probably damaging	Het
Zfp957	C	T	14: 79,212,922	C479Y	probably damaging	Het

Other mutations in Map2k5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Map2k5	APN	9	63281077	splice site	probably benign
IGL01412:Map2k5	APN	9	63293706	missense	probably damaging	1.00
IGL01766:Map2k5	APN	9	63377227	missense	probably benign
IGL02246:Map2k5	APN	9	63377129	missense	probably benign	0.10
IGL02270:Map2k5	APN	9	63322197	splice site	probably null
IGL02793:Map2k5	APN	9	63257039	missense	probably benign	0.32
IGL03236:Map2k5	APN	9	63286392	splice site	probably benign
R0007:Map2k5	UTSW	9	63293724	missense	probably damaging	1.00
R0217:Map2k5	UTSW	9	63256975	critical splice donor site	probably null
R0315:Map2k5	UTSW	9	63303151	missense	probably damaging	1.00
R0801:Map2k5	UTSW	9	63357979	splice site	probably benign
R1122:Map2k5	UTSW	9	63263163	missense	probably damaging	1.00
R1822:Map2k5	UTSW	9	63235303	missense	possibly damaging	0.79
R4308:Map2k5	UTSW	9	63235304	missense	probably benign	0.02
R4421:Map2k5	UTSW	9	63164130	missense	probably damaging	0.96
R4720:Map2k5	UTSW	9	63293719	missense	probably damaging	1.00
R4869:Map2k5	UTSW	9	63322243	nonsense	probably null
R5059:Map2k5	UTSW	9	63257014	missense	probably benign	0.41
R6005:Map2k5	UTSW	9	63281019	missense	probably damaging	1.00
R6258:Map2k5	UTSW	9	63217365	missense	probably benign	0.16
R6261:Map2k5	UTSW	9	63338098	missense	probably benign	0.00
R6498:Map2k5	UTSW	9	63286401	missense	possibly damaging	0.74
R6808:Map2k5	UTSW	9	63322246	missense	probably benign	0.00
R7228:Map2k5	UTSW	9	63358022	missense	probably damaging	1.00
R7819:Map2k5	UTSW	9	63358018	missense	probably damaging	0.99
R8017:Map2k5	UTSW	9	63339121	missense	probably damaging	0.98
R8053:Map2k5	UTSW	9	63343425	missense	probably benign	0.16
R8247:Map2k5	UTSW	9	63371737	missense	probably damaging	1.00
R8309:Map2k5	UTSW	9	63339079	critical splice donor site	probably null
R8341:Map2k5	UTSW	9	63339098	missense	probably damaging	1.00
Z1176:Map2k5	UTSW	9	63358038	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ATTCTGATGAAGGAAACTGCTCAGAG -3'
(R):5'- CCAAGGTTTGAGTGTACTTGC -3'

Sequencing Primer
(F):5'- GATTAAAAATGAATAACGCCTGCCG -3'
(R):5'- ACTTGCATTTGAATAGGTTTTGGCC -3'

Posted On

2016-06-21