Incidental Mutation 'R5138:Cacna1d'
ID396311
Institutional Source Beutler Lab
Gene Symbol Cacna1d
Ensembl Gene ENSMUSG00000015968
Gene Namecalcium channel, voltage-dependent, L type, alpha 1D subunit
SynonymsC79217, Cchl1a2, Cav1.3alpha1, Cchl1a, Cacnl1a2, D-LTCC, 8430418G19Rik
MMRRC Submission 042724-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.648) question?
Stock #R5138 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location30039939-30491455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 30490972 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 44 (A44S)
Ref Sequence ENSEMBL: ENSMUSP00000107869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022535] [ENSMUST00000112250] [ENSMUST00000225196] [ENSMUST00000225286]
Predicted Effect probably benign
Transcript: ENSMUST00000022535
SMART Domains Protein: ENSMUSP00000022535
Gene: ENSMUSG00000021962

DomainStartEndE-ValueType
Pfam:DCP1 28 144 1.8e-44 PFAM
low complexity region 327 343 N/A INTRINSIC
low complexity region 457 472 N/A INTRINSIC
Pfam:mRNA_decap_C 559 601 6.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112250
AA Change: A44S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107869
Gene: ENSMUSG00000015968
AA Change: A44S

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
Pfam:Ion_trans 147 439 5.6e-72 PFAM
low complexity region 473 482 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
Pfam:Ion_trans 544 784 2e-56 PFAM
low complexity region 788 803 N/A INTRINSIC
low complexity region 841 862 N/A INTRINSIC
Pfam:Ion_trans 907 1185 2.6e-63 PFAM
Pfam:Ion_trans 1226 1482 1.7e-70 PFAM
Pfam:PKD_channel 1306 1477 1.2e-9 PFAM
Pfam:GPHH 1484 1553 2.3e-38 PFAM
Ca_chan_IQ 1605 1639 5.05e-16 SMART
Pfam:CAC1F_C 1649 2165 1.1e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225124
Predicted Effect probably benign
Transcript: ENSMUST00000225196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225243
Predicted Effect probably benign
Transcript: ENSMUST00000225286
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225521
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225923
Meta Mutation Damage Score 0.1292 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: This gene encodes a pore-forming subunit of the L-type, voltage-activated calcium channel family. These channels have been found to play a role in heart and smooth muscle contraction and in the transmission of auditory information. Homozygous knockout mice for this gene exhibit deafness and heart defects. These channels have also been linked to mitochondrial oxidative stress in a mouse model of Parkinson's disease. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes for targeted mutations exhibit small size, hypoinsulinemia, glucose intolerance, decreased number and size of pancreatic islets, deafness with degeneration of hair cells, bradycardia, and arrhythmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik C A 9: 46,306,821 probably null Het
Actr10 G A 12: 70,961,879 G362E probably damaging Het
Aldh1a3 T C 7: 66,407,852 T278A probably damaging Het
Arpp21 T A 9: 112,179,084 K116M probably damaging Het
Arrdc3 T C 13: 80,891,065 Y72H probably damaging Het
Atr T C 9: 95,937,596 V2212A probably benign Het
Bcdin3d A G 15: 99,471,051 F89S possibly damaging Het
Cbx3 A G 6: 51,475,289 E28G probably damaging Het
Cdh23 A T 10: 60,312,282 F2722L probably damaging Het
Clec11a A G 7: 44,304,638 V297A probably benign Het
Clk2 C A 3: 89,175,499 probably benign Het
Clybl T A 14: 122,371,304 C103S possibly damaging Het
Col12a1 T A 9: 79,643,966 N2123Y probably damaging Het
Corin G A 5: 72,339,059 P517L probably damaging Het
Ddhd2 A T 8: 25,727,699 I717N probably damaging Het
Derl2 C A 11: 71,014,564 G31* probably null Het
Dgcr8 A G 16: 18,278,077 V523A probably damaging Het
Dnah8 T C 17: 30,765,597 S3090P probably damaging Het
Dsp C A 13: 38,183,298 H641N probably benign Het
Dsp A T 13: 38,195,845 T1590S possibly damaging Het
Duox2 A T 2: 122,297,531 L57Q probably damaging Het
Etfdh A T 3: 79,623,573 V47D probably benign Het
Exoc1 T C 5: 76,568,075 Y823H probably damaging Het
Fam81a C T 9: 70,099,175 R185K probably benign Het
Fsip2 A G 2: 82,981,424 I2696V probably benign Het
Glis1 GCACACA GCACA 4: 107,623,105 probably null Het
Gm15448 A T 7: 3,824,557 Y200* probably null Het
Gtf3c1 A T 7: 125,647,492 N1548K probably benign Het
Hist1h3b G A 13: 23,752,630 R84H probably damaging Het
Hkdc1 A T 10: 62,398,691 I575N probably damaging Het
Ifi208 A G 1: 173,690,673 I449V probably null Het
Ino80 T C 2: 119,383,421 T1223A probably damaging Het
Kctd9 T C 14: 67,728,748 probably null Het
Khdrbs1 A G 4: 129,741,854 Y103H probably benign Het
Kmt2e A G 5: 23,502,695 H1752R probably damaging Het
Lrp5 T A 19: 3,628,319 Q512L probably benign Het
Map2k5 T C 9: 63,263,158 T293A probably damaging Het
Myo7a C A 7: 98,083,599 R657L probably damaging Het
Myrfl A G 10: 116,796,058 probably null Het
Nfatc2 G A 2: 168,536,309 H258Y probably damaging Het
Nup205 T A 6: 35,225,866 L1336Q probably damaging Het
Olfr1218 T C 2: 89,054,947 I160V probably benign Het
Olfr1436 T C 19: 12,298,776 M119V possibly damaging Het
Olfr419 A G 1: 174,250,829 S33P probably damaging Het
Otog T A 7: 46,250,006 S244T possibly damaging Het
Pcdh17 T G 14: 84,447,209 I372S probably damaging Het
Plagl1 A G 10: 13,128,175 probably benign Het
Pnpla7 T C 2: 25,041,103 F910S possibly damaging Het
Prdm13 G A 4: 21,679,507 P328S unknown Het
Prdm5 C T 6: 65,856,102 Q152* probably null Het
Psat1 A G 19: 15,914,948 F216S possibly damaging Het
Psg21 A T 7: 18,656,528 M1K probably null Het
Rab11fip3 A T 17: 25,991,026 S994T probably benign Het
Rax A G 18: 65,938,318 probably benign Het
Rgs22 A T 15: 36,099,788 S260R probably benign Het
Ryr2 A T 13: 11,660,289 H3317Q probably damaging Het
Sc5d A G 9: 42,255,515 Y243H probably damaging Het
Serpinf1 T C 11: 75,415,028 E178G probably damaging Het
Slc15a3 A T 19: 10,856,005 Y462F probably damaging Het
Slc9b1 G A 3: 135,357,773 probably benign Het
Slit2 C T 5: 48,281,967 P1111S probably damaging Het
Slit3 T C 11: 35,588,985 Y330H probably damaging Het
Snw1 T C 12: 87,460,435 K204E probably benign Het
Steap1 A G 5: 5,736,486 I317T probably damaging Het
Sval2 A G 6: 41,861,945 N20S probably damaging Het
Tfrc C A 16: 32,615,209 Y85* probably null Het
Tmem87a T C 2: 120,371,545 T412A possibly damaging Het
Utp20 T C 10: 88,747,377 K2705E probably damaging Het
Vmn1r230 A T 17: 20,846,968 K140* probably null Het
Vmn2r62 A T 7: 42,764,816 H734Q possibly damaging Het
Zbtb8os T A 4: 129,346,926 probably benign Het
Zfp608 A T 18: 54,891,799 H1466Q probably damaging Het
Zfp957 C T 14: 79,212,922 C479Y probably damaging Het
Other mutations in Cacna1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Cacna1d APN 14 30096950 missense probably damaging 0.97
IGL00857:Cacna1d APN 14 30350681 missense possibly damaging 0.83
IGL01015:Cacna1d APN 14 30051742 splice site probably benign
IGL01420:Cacna1d APN 14 30051638 missense probably benign 0.01
IGL01470:Cacna1d APN 14 30099142 missense probably damaging 0.99
IGL01560:Cacna1d APN 14 30099206 missense probably benign 0.00
IGL01617:Cacna1d APN 14 30102371 missense probably damaging 1.00
IGL01820:Cacna1d APN 14 30042866 missense possibly damaging 0.79
IGL01948:Cacna1d APN 14 30124794 missense probably damaging 1.00
IGL02702:Cacna1d APN 14 30123533 nonsense probably null
IGL02864:Cacna1d APN 14 30051706 missense probably benign 0.10
IGL03082:Cacna1d APN 14 30099233 missense probably damaging 1.00
brisk UTSW 14 30171314 missense possibly damaging 0.91
troppo UTSW 14 30123454 missense probably damaging 1.00
PIT4651001:Cacna1d UTSW 14 30178645 missense probably damaging 1.00
R0015:Cacna1d UTSW 14 30114971 missense probably benign 0.00
R0015:Cacna1d UTSW 14 30114971 missense probably benign 0.00
R0033:Cacna1d UTSW 14 30105489 missense probably damaging 0.99
R0047:Cacna1d UTSW 14 30346790 splice site probably benign
R0047:Cacna1d UTSW 14 30346790 splice site probably benign
R0051:Cacna1d UTSW 14 30111095 missense probably damaging 1.00
R0051:Cacna1d UTSW 14 30111095 missense probably damaging 1.00
R0067:Cacna1d UTSW 14 30075010 unclassified probably benign
R0067:Cacna1d UTSW 14 30075010 unclassified probably benign
R0238:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0238:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0239:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0239:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0240:Cacna1d UTSW 14 30096969 missense probably benign 0.00
R0240:Cacna1d UTSW 14 30096969 missense probably benign 0.00
R0284:Cacna1d UTSW 14 30072105 missense probably damaging 1.00
R0416:Cacna1d UTSW 14 30100688 splice site probably benign
R0427:Cacna1d UTSW 14 30346817 missense probably damaging 0.99
R0517:Cacna1d UTSW 14 30179275 missense probably damaging 1.00
R0639:Cacna1d UTSW 14 30171294 critical splice donor site probably null
R0727:Cacna1d UTSW 14 30130115 critical splice donor site probably null
R0732:Cacna1d UTSW 14 30042920 missense probably damaging 0.99
R0843:Cacna1d UTSW 14 30124871 missense probably damaging 1.00
R0900:Cacna1d UTSW 14 30111082 missense probably damaging 1.00
R1278:Cacna1d UTSW 14 30178703 missense probably damaging 1.00
R1340:Cacna1d UTSW 14 30072067 missense probably damaging 0.96
R1527:Cacna1d UTSW 14 30107796 missense probably damaging 1.00
R1711:Cacna1d UTSW 14 30066056 missense probably damaging 1.00
R1736:Cacna1d UTSW 14 30089863 missense probably damaging 1.00
R1763:Cacna1d UTSW 14 30099196 missense probably benign 0.25
R2034:Cacna1d UTSW 14 30089863 missense probably damaging 1.00
R2086:Cacna1d UTSW 14 30047357 missense possibly damaging 0.83
R2126:Cacna1d UTSW 14 30123163 missense probably damaging 1.00
R2218:Cacna1d UTSW 14 30123091 missense probably damaging 1.00
R2219:Cacna1d UTSW 14 30042090 missense probably damaging 1.00
R2262:Cacna1d UTSW 14 30491016 missense possibly damaging 0.46
R2291:Cacna1d UTSW 14 30042342 missense probably damaging 1.00
R2399:Cacna1d UTSW 14 30052487 missense probably benign 0.34
R2424:Cacna1d UTSW 14 30049023 missense probably damaging 0.96
R2568:Cacna1d UTSW 14 30082511 missense probably damaging 0.99
R4038:Cacna1d UTSW 14 30066083 missense probably damaging 0.96
R4509:Cacna1d UTSW 14 30096971 missense probably damaging 1.00
R4649:Cacna1d UTSW 14 30095408 missense probably benign
R4650:Cacna1d UTSW 14 30095408 missense probably benign
R4652:Cacna1d UTSW 14 30095408 missense probably benign
R5009:Cacna1d UTSW 14 30079332 missense probably damaging 1.00
R5058:Cacna1d UTSW 14 30114244 nonsense probably null
R5063:Cacna1d UTSW 14 30051383 missense probably benign
R5151:Cacna1d UTSW 14 30123323 missense probably damaging 1.00
R5278:Cacna1d UTSW 14 30352924 critical splice donor site probably null
R5286:Cacna1d UTSW 14 30350725 missense possibly damaging 0.69
R5313:Cacna1d UTSW 14 30346841 missense probably benign 0.38
R5383:Cacna1d UTSW 14 30045279 missense possibly damaging 0.51
R5387:Cacna1d UTSW 14 30100751 missense probably damaging 1.00
R5514:Cacna1d UTSW 14 30350833 nonsense probably null
R5524:Cacna1d UTSW 14 30042129 missense probably benign 0.01
R5663:Cacna1d UTSW 14 30123340 missense probably damaging 1.00
R5712:Cacna1d UTSW 14 30074997 missense probably damaging 1.00
R5796:Cacna1d UTSW 14 30066116 missense probably damaging 1.00
R5906:Cacna1d UTSW 14 30096960 missense probably damaging 1.00
R5923:Cacna1d UTSW 14 30111148 missense probably damaging 1.00
R5936:Cacna1d UTSW 14 30171314 missense possibly damaging 0.91
R5938:Cacna1d UTSW 14 30103735 missense probably damaging 1.00
R6041:Cacna1d UTSW 14 30042357 missense probably damaging 1.00
R6432:Cacna1d UTSW 14 30123454 missense probably damaging 1.00
R6486:Cacna1d UTSW 14 30114233 missense probably benign 0.01
R6600:Cacna1d UTSW 14 30114235 missense probably benign 0.15
R6661:Cacna1d UTSW 14 30089875 missense probably damaging 1.00
R6753:Cacna1d UTSW 14 30042786 missense probably damaging 1.00
R6804:Cacna1d UTSW 14 30051665 missense probably benign 0.00
R6851:Cacna1d UTSW 14 30042782 missense probably damaging 1.00
R6863:Cacna1d UTSW 14 30075852 missense probably damaging 1.00
R6916:Cacna1d UTSW 14 30095364 missense probably damaging 1.00
R6925:Cacna1d UTSW 14 30051637 missense probably benign
R7066:Cacna1d UTSW 14 30352978 intron probably benign
R7188:Cacna1d UTSW 14 30089833 missense probably benign
R7242:Cacna1d UTSW 14 30178706 missense probably benign 0.00
R7249:Cacna1d UTSW 14 30142703 missense probably damaging 1.00
R7250:Cacna1d UTSW 14 30075151 missense probably damaging 1.00
R7274:Cacna1d UTSW 14 30142643 missense probably damaging 1.00
R7336:Cacna1d UTSW 14 30045282 missense probably benign 0.18
R7343:Cacna1d UTSW 14 30123057 missense probably benign 0.02
R7411:Cacna1d UTSW 14 30352990 start codon destroyed probably null
R7461:Cacna1d UTSW 14 30066163 missense probably benign 0.05
R7534:Cacna1d UTSW 14 30079362 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAACACCTGGACGTGTCC -3'
(R):5'- TACAACTTTCCGCTCGGTG -3'

Sequencing Primer
(F):5'- CCTGACACTTTTAAGCAGTAGCAG -3'
(R):5'- CGGTGGCTGTATTTTCAACAC -3'
Posted On2016-06-21