Incidental Mutation 'R5138:Rgs22'
ID396316
Institutional Source Beutler Lab
Gene Symbol Rgs22
Ensembl Gene ENSMUSG00000037627
Gene Nameregulator of G-protein signalling 22
Synonyms
MMRRC Submission 042724-MU
Accession Numbers

Genbank: NM_001195748; MGI: 3613651

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5138 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location36009479-36140400 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36099788 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 260 (S260R)
Ref Sequence ENSEMBL: ENSMUSP00000134185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172831] [ENSMUST00000174881]
Predicted Effect probably benign
Transcript: ENSMUST00000172831
AA Change: S384R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000134259
Gene: ENSMUSG00000037627
AA Change: S384R

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 62 76 N/A INTRINSIC
low complexity region 173 179 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
RGS 845 973 3.15e-2 SMART
RGS 1014 1134 1.56e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174881
AA Change: S260R

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000134185
Gene: ENSMUSG00000037627
AA Change: S260R

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
RGS 721 849 3.15e-2 SMART
RGS 890 1010 1.56e-15 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 97% (76/78)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik C A 9: 46,306,821 probably null Het
Actr10 G A 12: 70,961,879 G362E probably damaging Het
Aldh1a3 T C 7: 66,407,852 T278A probably damaging Het
Arpp21 T A 9: 112,179,084 K116M probably damaging Het
Arrdc3 T C 13: 80,891,065 Y72H probably damaging Het
Atr T C 9: 95,937,596 V2212A probably benign Het
Bcdin3d A G 15: 99,471,051 F89S possibly damaging Het
Cacna1d C A 14: 30,490,972 A44S probably benign Het
Cbx3 A G 6: 51,475,289 E28G probably damaging Het
Cdh23 A T 10: 60,312,282 F2722L probably damaging Het
Clec11a A G 7: 44,304,638 V297A probably benign Het
Clk2 C A 3: 89,175,499 probably benign Het
Clybl T A 14: 122,371,304 C103S possibly damaging Het
Col12a1 T A 9: 79,643,966 N2123Y probably damaging Het
Corin G A 5: 72,339,059 P517L probably damaging Het
Ddhd2 A T 8: 25,727,699 I717N probably damaging Het
Derl2 C A 11: 71,014,564 G31* probably null Het
Dgcr8 A G 16: 18,278,077 V523A probably damaging Het
Dnah8 T C 17: 30,765,597 S3090P probably damaging Het
Dsp C A 13: 38,183,298 H641N probably benign Het
Dsp A T 13: 38,195,845 T1590S possibly damaging Het
Duox2 A T 2: 122,297,531 L57Q probably damaging Het
Etfdh A T 3: 79,623,573 V47D probably benign Het
Exoc1 T C 5: 76,568,075 Y823H probably damaging Het
Fam81a C T 9: 70,099,175 R185K probably benign Het
Fsip2 A G 2: 82,981,424 I2696V probably benign Het
Glis1 GCACACA GCACA 4: 107,623,105 probably null Het
Gm15448 A T 7: 3,824,557 Y200* probably null Het
Gtf3c1 A T 7: 125,647,492 N1548K probably benign Het
Hist1h3b G A 13: 23,752,630 R84H probably damaging Het
Hkdc1 A T 10: 62,398,691 I575N probably damaging Het
Ifi208 A G 1: 173,690,673 I449V probably null Het
Ino80 T C 2: 119,383,421 T1223A probably damaging Het
Kctd9 T C 14: 67,728,748 probably null Het
Khdrbs1 A G 4: 129,741,854 Y103H probably benign Het
Kmt2e A G 5: 23,502,695 H1752R probably damaging Het
Lrp5 T A 19: 3,628,319 Q512L probably benign Het
Map2k5 T C 9: 63,263,158 T293A probably damaging Het
Myo7a C A 7: 98,083,599 R657L probably damaging Het
Myrfl A G 10: 116,796,058 probably null Het
Nfatc2 G A 2: 168,536,309 H258Y probably damaging Het
Nup205 T A 6: 35,225,866 L1336Q probably damaging Het
Olfr1218 T C 2: 89,054,947 I160V probably benign Het
Olfr1436 T C 19: 12,298,776 M119V possibly damaging Het
Olfr419 A G 1: 174,250,829 S33P probably damaging Het
Otog T A 7: 46,250,006 S244T possibly damaging Het
Pcdh17 T G 14: 84,447,209 I372S probably damaging Het
Plagl1 A G 10: 13,128,175 probably benign Het
Pnpla7 T C 2: 25,041,103 F910S possibly damaging Het
Prdm13 G A 4: 21,679,507 P328S unknown Het
Prdm5 C T 6: 65,856,102 Q152* probably null Het
Psat1 A G 19: 15,914,948 F216S possibly damaging Het
Psg21 A T 7: 18,656,528 M1K probably null Het
Rab11fip3 A T 17: 25,991,026 S994T probably benign Het
Rax A G 18: 65,938,318 probably benign Het
Ryr2 A T 13: 11,660,289 H3317Q probably damaging Het
Sc5d A G 9: 42,255,515 Y243H probably damaging Het
Serpinf1 T C 11: 75,415,028 E178G probably damaging Het
Slc15a3 A T 19: 10,856,005 Y462F probably damaging Het
Slc9b1 G A 3: 135,357,773 probably benign Het
Slit2 C T 5: 48,281,967 P1111S probably damaging Het
Slit3 T C 11: 35,588,985 Y330H probably damaging Het
Snw1 T C 12: 87,460,435 K204E probably benign Het
Steap1 A G 5: 5,736,486 I317T probably damaging Het
Sval2 A G 6: 41,861,945 N20S probably damaging Het
Tfrc C A 16: 32,615,209 Y85* probably null Het
Tmem87a T C 2: 120,371,545 T412A possibly damaging Het
Utp20 T C 10: 88,747,377 K2705E probably damaging Het
Vmn1r230 A T 17: 20,846,968 K140* probably null Het
Vmn2r62 A T 7: 42,764,816 H734Q possibly damaging Het
Zbtb8os T A 4: 129,346,926 probably benign Het
Zfp608 A T 18: 54,891,799 H1466Q probably damaging Het
Zfp957 C T 14: 79,212,922 C479Y probably damaging Het
Other mutations in Rgs22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Rgs22 APN 15 36099931 missense possibly damaging 0.93
IGL00594:Rgs22 APN 15 36083631 missense probably benign 0.00
IGL01464:Rgs22 APN 15 36083641 missense possibly damaging 0.90
IGL01686:Rgs22 APN 15 36103835 missense probably benign 0.00
IGL01761:Rgs22 APN 15 36103751 missense probably damaging 0.99
IGL02045:Rgs22 APN 15 36013154 missense probably benign 0.33
IGL02378:Rgs22 APN 15 36103805 missense probably benign 0.00
IGL02490:Rgs22 APN 15 36054847 missense probably damaging 1.00
IGL03219:Rgs22 APN 15 36107048 missense probably damaging 1.00
IGL03229:Rgs22 APN 15 36015779 splice site probably benign
IGL03328:Rgs22 APN 15 36043204 critical splice donor site probably null
3-1:Rgs22 UTSW 15 36100036 missense possibly damaging 0.48
R0254:Rgs22 UTSW 15 36104552 missense probably damaging 0.99
R0463:Rgs22 UTSW 15 36092938 missense probably damaging 1.00
R0467:Rgs22 UTSW 15 36099795 nonsense probably null
R0486:Rgs22 UTSW 15 36092882 missense probably damaging 0.98
R0554:Rgs22 UTSW 15 36054709 missense probably benign 0.10
R0602:Rgs22 UTSW 15 36139872 splice site probably benign
R0906:Rgs22 UTSW 15 36103902 intron probably benign
R1159:Rgs22 UTSW 15 36040693 missense probably damaging 1.00
R1300:Rgs22 UTSW 15 36101762 missense probably benign 0.43
R1439:Rgs22 UTSW 15 36025793 splice site probably benign
R1491:Rgs22 UTSW 15 36092901 missense probably damaging 0.98
R1502:Rgs22 UTSW 15 36080851 missense probably damaging 1.00
R1514:Rgs22 UTSW 15 36013100 missense probably benign 0.00
R1538:Rgs22 UTSW 15 36048776 missense probably damaging 1.00
R1784:Rgs22 UTSW 15 36087436 missense probably damaging 1.00
R1938:Rgs22 UTSW 15 36101804 missense probably benign 0.00
R1972:Rgs22 UTSW 15 36103836 missense probably benign 0.01
R2109:Rgs22 UTSW 15 36099734 nonsense probably null
R2208:Rgs22 UTSW 15 36050232 missense probably benign 0.01
R3696:Rgs22 UTSW 15 36099892 missense probably benign 0.00
R3697:Rgs22 UTSW 15 36099892 missense probably benign 0.00
R3698:Rgs22 UTSW 15 36099892 missense probably benign 0.00
R3879:Rgs22 UTSW 15 36106905 missense possibly damaging 0.52
R4080:Rgs22 UTSW 15 36107076 missense probably damaging 1.00
R4363:Rgs22 UTSW 15 36103874 missense probably damaging 0.99
R4591:Rgs22 UTSW 15 36100136 missense probably benign 0.01
R4673:Rgs22 UTSW 15 36099933 missense probably benign 0.04
R4829:Rgs22 UTSW 15 36103888 missense probably damaging 1.00
R4831:Rgs22 UTSW 15 36050148 missense probably benign 0.00
R4865:Rgs22 UTSW 15 36100212 missense probably damaging 1.00
R4907:Rgs22 UTSW 15 36087424 missense possibly damaging 0.61
R4944:Rgs22 UTSW 15 36025942 missense possibly damaging 0.83
R4975:Rgs22 UTSW 15 36054876 nonsense probably null
R5056:Rgs22 UTSW 15 36050245 unclassified probably null
R5126:Rgs22 UTSW 15 36040644 missense probably damaging 0.96
R5444:Rgs22 UTSW 15 36015627 missense possibly damaging 0.83
R5507:Rgs22 UTSW 15 36099652 missense probably damaging 0.99
R5640:Rgs22 UTSW 15 36106955 missense probably benign 0.00
R5969:Rgs22 UTSW 15 36015636 missense probably benign 0.00
R6005:Rgs22 UTSW 15 36010567 missense probably benign 0.39
R6053:Rgs22 UTSW 15 36100007 missense probably benign 0.04
R6134:Rgs22 UTSW 15 36107048 missense probably damaging 1.00
R6230:Rgs22 UTSW 15 36100030 missense probably benign 0.02
R6295:Rgs22 UTSW 15 36087374 missense probably benign 0.00
R6352:Rgs22 UTSW 15 36092921 missense probably damaging 1.00
R6809:Rgs22 UTSW 15 36048764 missense probably damaging 1.00
R6900:Rgs22 UTSW 15 36010747 missense possibly damaging 0.61
R6947:Rgs22 UTSW 15 36103890 critical splice acceptor site probably null
R7102:Rgs22 UTSW 15 36122313 missense probably damaging 1.00
R7126:Rgs22 UTSW 15 36103808 missense probably damaging 0.97
R7263:Rgs22 UTSW 15 36015643 missense possibly damaging 0.86
R7623:Rgs22 UTSW 15 36040710 missense probably benign 0.08
R7732:Rgs22 UTSW 15 36025981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCCTTAAGAACTTTCAGCCTC -3'
(R):5'- CGGTTGAAGAATTCCTAGATGCC -3'

Sequencing Primer
(F):5'- AAGAACTTTCAGCCTCTCTATGTC -3'
(R):5'- TTTATCCTGAGAGAGGCCATCCAG -3'
Posted On2016-06-21