Incidental Mutation 'R5138:Rax'
ID396324
Institutional Source Beutler Lab
Gene Symbol Rax
Ensembl Gene ENSMUSG00000024518
Gene Nameretina and anterior neural fold homeobox
Synonymsey1, Rx, E130303K03Rik
MMRRC Submission 042724-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.630) question?
Stock #R5138 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location65934639-65939089 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 65938318 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025396]
Predicted Effect probably benign
Transcript: ENSMUST00000025396
SMART Domains Protein: ENSMUSP00000025396
Gene: ENSMUSG00000024518

DomainStartEndE-ValueType
low complexity region 128 135 N/A INTRINSIC
HOX 136 198 1.25e-27 SMART
low complexity region 207 253 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
Pfam:OAR 314 334 1.4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181100
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homeobox-containing transcription factor that functions in eye development. The gene is expressed early in the eye primordia, and is required for retinal cell fate determination and also regulates stem cell proliferation. Mutations in this gene have been reported in patients with defects in ocular development, including microphthalmia, anophthalmia, and coloboma.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mutants die neonatally with severe brain defects including absence of forebrain/midbrain structures and fail to form eye structures. Homozygous hypomorph mutants are viable, but lack eyes and optic tracts and have hypothalamic defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik C A 9: 46,306,821 probably null Het
Actr10 G A 12: 70,961,879 G362E probably damaging Het
Aldh1a3 T C 7: 66,407,852 T278A probably damaging Het
Arpp21 T A 9: 112,179,084 K116M probably damaging Het
Arrdc3 T C 13: 80,891,065 Y72H probably damaging Het
Atr T C 9: 95,937,596 V2212A probably benign Het
Bcdin3d A G 15: 99,471,051 F89S possibly damaging Het
Cacna1d C A 14: 30,490,972 A44S probably benign Het
Cbx3 A G 6: 51,475,289 E28G probably damaging Het
Cdh23 A T 10: 60,312,282 F2722L probably damaging Het
Clec11a A G 7: 44,304,638 V297A probably benign Het
Clk2 C A 3: 89,175,499 probably benign Het
Clybl T A 14: 122,371,304 C103S possibly damaging Het
Col12a1 T A 9: 79,643,966 N2123Y probably damaging Het
Corin G A 5: 72,339,059 P517L probably damaging Het
Ddhd2 A T 8: 25,727,699 I717N probably damaging Het
Derl2 C A 11: 71,014,564 G31* probably null Het
Dgcr8 A G 16: 18,278,077 V523A probably damaging Het
Dnah8 T C 17: 30,765,597 S3090P probably damaging Het
Dsp C A 13: 38,183,298 H641N probably benign Het
Dsp A T 13: 38,195,845 T1590S possibly damaging Het
Duox2 A T 2: 122,297,531 L57Q probably damaging Het
Etfdh A T 3: 79,623,573 V47D probably benign Het
Exoc1 T C 5: 76,568,075 Y823H probably damaging Het
Fam81a C T 9: 70,099,175 R185K probably benign Het
Fsip2 A G 2: 82,981,424 I2696V probably benign Het
Glis1 GCACACA GCACA 4: 107,623,105 probably null Het
Gm15448 A T 7: 3,824,557 Y200* probably null Het
Gtf3c1 A T 7: 125,647,492 N1548K probably benign Het
Hist1h3b G A 13: 23,752,630 R84H probably damaging Het
Hkdc1 A T 10: 62,398,691 I575N probably damaging Het
Ifi208 A G 1: 173,690,673 I449V probably null Het
Ino80 T C 2: 119,383,421 T1223A probably damaging Het
Kctd9 T C 14: 67,728,748 probably null Het
Khdrbs1 A G 4: 129,741,854 Y103H probably benign Het
Kmt2e A G 5: 23,502,695 H1752R probably damaging Het
Lrp5 T A 19: 3,628,319 Q512L probably benign Het
Map2k5 T C 9: 63,263,158 T293A probably damaging Het
Myo7a C A 7: 98,083,599 R657L probably damaging Het
Myrfl A G 10: 116,796,058 probably null Het
Nfatc2 G A 2: 168,536,309 H258Y probably damaging Het
Nup205 T A 6: 35,225,866 L1336Q probably damaging Het
Olfr1218 T C 2: 89,054,947 I160V probably benign Het
Olfr1436 T C 19: 12,298,776 M119V possibly damaging Het
Olfr419 A G 1: 174,250,829 S33P probably damaging Het
Otog T A 7: 46,250,006 S244T possibly damaging Het
Pcdh17 T G 14: 84,447,209 I372S probably damaging Het
Plagl1 A G 10: 13,128,175 probably benign Het
Pnpla7 T C 2: 25,041,103 F910S possibly damaging Het
Prdm13 G A 4: 21,679,507 P328S unknown Het
Prdm5 C T 6: 65,856,102 Q152* probably null Het
Psat1 A G 19: 15,914,948 F216S possibly damaging Het
Psg21 A T 7: 18,656,528 M1K probably null Het
Rab11fip3 A T 17: 25,991,026 S994T probably benign Het
Rgs22 A T 15: 36,099,788 S260R probably benign Het
Ryr2 A T 13: 11,660,289 H3317Q probably damaging Het
Sc5d A G 9: 42,255,515 Y243H probably damaging Het
Serpinf1 T C 11: 75,415,028 E178G probably damaging Het
Slc15a3 A T 19: 10,856,005 Y462F probably damaging Het
Slc9b1 G A 3: 135,357,773 probably benign Het
Slit2 C T 5: 48,281,967 P1111S probably damaging Het
Slit3 T C 11: 35,588,985 Y330H probably damaging Het
Snw1 T C 12: 87,460,435 K204E probably benign Het
Steap1 A G 5: 5,736,486 I317T probably damaging Het
Sval2 A G 6: 41,861,945 N20S probably damaging Het
Tfrc C A 16: 32,615,209 Y85* probably null Het
Tmem87a T C 2: 120,371,545 T412A possibly damaging Het
Utp20 T C 10: 88,747,377 K2705E probably damaging Het
Vmn1r230 A T 17: 20,846,968 K140* probably null Het
Vmn2r62 A T 7: 42,764,816 H734Q possibly damaging Het
Zbtb8os T A 4: 129,346,926 probably benign Het
Zfp608 A T 18: 54,891,799 H1466Q probably damaging Het
Zfp957 C T 14: 79,212,922 C479Y probably damaging Het
Other mutations in Rax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02542:Rax APN 18 65938630 missense possibly damaging 0.68
IGL03290:Rax APN 18 65938160 missense probably damaging 1.00
R4210:Rax UTSW 18 65935081 missense unknown
R4211:Rax UTSW 18 65935081 missense unknown
R6039:Rax UTSW 18 65935347 missense unknown
R6039:Rax UTSW 18 65935347 missense unknown
R6235:Rax UTSW 18 65935161 missense unknown
R6578:Rax UTSW 18 65938667 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TAGTGGGACTTCTCGAAGGC -3'
(R):5'- GTACGAAGGTGAGTGCTCAG -3'

Sequencing Primer
(F):5'- CCAGCTCGTGCAGTTGGTAAG -3'
(R):5'- AAGGCTGCAAAGTCCCTG -3'
Posted On2016-06-21