Incidental Mutation 'R5139:Aox1'
ID396329
Institutional Source Beutler Lab
Gene Symbol Aox1
Ensembl Gene ENSMUSG00000063558
Gene Namealdehyde oxidase 1
SynonymsAox-1, Aox2, retinal oxidase, Aox-2
MMRRC Submission 042725-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5139 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location58029931-58106413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58061297 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 418 (S418P)
Ref Sequence ENSEMBL: ENSMUSP00000001027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001027]
Predicted Effect probably benign
Transcript: ENSMUST00000001027
AA Change: S418P

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000001027
Gene: ENSMUSG00000063558
AA Change: S418P

DomainStartEndE-ValueType
Pfam:Fer2 8 78 8.5e-11 PFAM
Pfam:Fer2_2 87 161 2.4e-32 PFAM
low complexity region 197 209 N/A INTRINSIC
Pfam:FAD_binding_5 238 418 1.2e-46 PFAM
CO_deh_flav_C 425 529 8.06e-24 SMART
Ald_Xan_dh_C 593 696 6.99e-42 SMART
Pfam:Ald_Xan_dh_C2 707 1240 2.1e-176 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160168
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aldehyde oxidase produces hydrogen peroxide and, under certain conditions, can catalyze the formation of superoxide. Aldehyde oxidase is a candidate gene for amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,448 L625P probably damaging Het
Agtpbp1 A G 13: 59,500,213 S598P probably damaging Het
Ahnak A C 19: 9,004,655 D1101A probably damaging Het
Aoah T C 13: 21,023,237 V542A possibly damaging Het
Appl1 A G 14: 26,947,155 I354T probably benign Het
BC035947 T C 1: 78,499,247 E216G possibly damaging Het
Bnip3l A G 14: 66,999,615 S63P probably damaging Het
C130060K24Rik A T 6: 65,456,219 N341I probably damaging Het
Cckar T C 5: 53,702,923 N188S probably benign Het
Ccl24 C T 5: 135,572,921 A18T probably benign Het
Cmya5 A G 13: 93,096,061 C840R probably benign Het
Copa C T 1: 172,121,329 R1183W probably damaging Het
Dnah10 T C 5: 124,798,960 V2621A probably damaging Het
Fryl A G 5: 73,090,718 Y1019H probably damaging Het
Hira T C 16: 18,954,758 Y943H probably damaging Het
Ighv3-8 T C 12: 114,322,374 Y116C probably damaging Het
Igkv4-70 G A 6: 69,268,105 T44I probably damaging Het
Lce3c G A 3: 92,945,471 G80S unknown Het
Ldhb A T 6: 142,494,195 N206K probably damaging Het
Mical1 T A 10: 41,478,415 probably null Het
Myh2 T C 11: 67,179,348 L402P probably damaging Het
Naa15 T A 3: 51,443,840 L144I probably damaging Het
Nbea T A 3: 55,626,963 I2918F possibly damaging Het
Olfr1131 C A 2: 87,628,656 H64Q probably benign Het
Pdcd11 C A 19: 47,107,115 S625R probably benign Het
Pdlim7 A G 13: 55,507,056 S214P probably damaging Het
Polg T C 7: 79,450,025 D49G probably damaging Het
Polr2f C A 15: 79,151,658 D106E possibly damaging Het
Ppp6r3 A C 19: 3,464,610 N766K probably damaging Het
Prl8a1 T A 13: 27,574,066 D220V probably damaging Het
Sept9 A G 11: 117,356,685 K497E possibly damaging Het
Sfswap T G 5: 129,571,009 M927R possibly damaging Het
Smad9 T G 3: 54,797,406 W400G possibly damaging Het
St13 G C 15: 81,399,585 R4G probably benign Het
Tcaf3 A G 6: 42,596,933 V115A probably benign Het
Tesmin A G 19: 3,406,934 I238V probably damaging Het
Trf C T 9: 103,222,934 probably null Het
Trpc3 A T 3: 36,671,557 M90K possibly damaging Het
Tshz3 C T 7: 36,771,025 T813I probably benign Het
Tub T A 7: 109,011,102 M1K probably null Het
Wdfy3 A T 5: 101,849,267 probably null Het
Zfp853 T C 5: 143,288,815 Q350R unknown Het
Other mutations in Aox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Aox1 APN 1 58059044 missense probably damaging 1.00
IGL01077:Aox1 APN 1 58057410 splice site probably benign
IGL01335:Aox1 APN 1 58082153 nonsense probably null
IGL01410:Aox1 APN 1 58106025 splice site probably null
IGL01684:Aox1 APN 1 58077581 splice site probably null
IGL01727:Aox1 APN 1 58073228 nonsense probably null
IGL01805:Aox1 APN 1 58081513 missense possibly damaging 0.94
IGL01996:Aox1 APN 1 58082066 missense probably benign 0.11
IGL02060:Aox1 APN 1 58097955 missense possibly damaging 0.95
IGL02206:Aox1 APN 1 58065340 missense probably benign 0.00
IGL02839:Aox1 APN 1 58068784 missense probably benign 0.05
IGL02975:Aox1 APN 1 58068391 missense probably damaging 1.00
IGL03062:Aox1 APN 1 58078465 missense probably benign 0.01
IGL03286:Aox1 APN 1 58049384 missense probably benign 0.19
IGL03335:Aox1 APN 1 58076160 missense probably damaging 0.98
IGL03395:Aox1 APN 1 58068725 splice site probably benign
R0048:Aox1 UTSW 1 58073212 missense probably damaging 0.98
R0144:Aox1 UTSW 1 58070074 missense probably benign 0.00
R0207:Aox1 UTSW 1 58105014 missense possibly damaging 0.82
R0357:Aox1 UTSW 1 58092516 missense probably damaging 1.00
R0383:Aox1 UTSW 1 58061241 missense probably benign 0.00
R0399:Aox1 UTSW 1 58068849 splice site probably null
R0465:Aox1 UTSW 1 58062207 missense probably damaging 1.00
R0480:Aox1 UTSW 1 58043651 splice site probably benign
R1005:Aox1 UTSW 1 58065352 missense probably benign 0.00
R1507:Aox1 UTSW 1 58104451 missense probably benign 0.01
R1597:Aox1 UTSW 1 58047167 missense probably damaging 1.00
R1693:Aox1 UTSW 1 58085542 missense probably damaging 1.00
R1709:Aox1 UTSW 1 58077474 missense probably benign
R1869:Aox1 UTSW 1 58076103 missense probably damaging 1.00
R1870:Aox1 UTSW 1 58076103 missense probably damaging 1.00
R1898:Aox1 UTSW 1 58078442 missense probably damaging 1.00
R1908:Aox1 UTSW 1 58102624 missense probably damaging 1.00
R2002:Aox1 UTSW 1 58047141 missense possibly damaging 0.69
R2062:Aox1 UTSW 1 58059192 splice site probably null
R2065:Aox1 UTSW 1 58059192 splice site probably null
R2265:Aox1 UTSW 1 58081520 missense probably damaging 0.99
R3713:Aox1 UTSW 1 58056215 missense probably benign 0.01
R3778:Aox1 UTSW 1 58053703 missense possibly damaging 0.89
R4198:Aox1 UTSW 1 58085607 missense probably benign
R4296:Aox1 UTSW 1 58057400 splice site probably null
R4562:Aox1 UTSW 1 58059056 missense probably damaging 0.99
R4858:Aox1 UTSW 1 58104481 missense probably benign
R4862:Aox1 UTSW 1 58095157 missense probably damaging 0.98
R5048:Aox1 UTSW 1 58059482 splice site probably benign
R5127:Aox1 UTSW 1 58030026 missense probably benign 0.00
R5157:Aox1 UTSW 1 58070063 missense probably damaging 1.00
R5168:Aox1 UTSW 1 58049402 missense probably damaging 1.00
R5186:Aox1 UTSW 1 58068370 missense probably damaging 1.00
R5235:Aox1 UTSW 1 58057555 missense possibly damaging 0.77
R5289:Aox1 UTSW 1 58092558 missense probably damaging 0.99
R5466:Aox1 UTSW 1 58041460 missense probably damaging 1.00
R5540:Aox1 UTSW 1 58104410 missense probably benign 0.03
R5615:Aox1 UTSW 1 58096966 missense probably benign
R5652:Aox1 UTSW 1 58095197 missense probably damaging 1.00
R5920:Aox1 UTSW 1 58049472 missense probably damaging 1.00
R6008:Aox1 UTSW 1 58077513 missense probably damaging 1.00
R6073:Aox1 UTSW 1 58104509 critical splice donor site probably null
R6215:Aox1 UTSW 1 58085461 missense probably benign
R6403:Aox1 UTSW 1 58068435 missense probably damaging 1.00
R6440:Aox1 UTSW 1 58094472 missense probably damaging 1.00
R6601:Aox1 UTSW 1 58063506 missense probably damaging 1.00
R6608:Aox1 UTSW 1 58057546 missense probably benign 0.40
R6752:Aox1 UTSW 1 58047239 missense probably benign 0.00
R6989:Aox1 UTSW 1 58085452 missense probably damaging 1.00
R7042:Aox1 UTSW 1 58102600 missense probably damaging 0.99
R7442:Aox1 UTSW 1 58082013 missense probably damaging 1.00
R7506:Aox1 UTSW 1 58049403 missense probably damaging 1.00
R7563:Aox1 UTSW 1 58047145 missense probably benign 0.32
R7589:Aox1 UTSW 1 58041484 missense probably damaging 1.00
R7735:Aox1 UTSW 1 58068292 missense probably benign 0.01
R7814:Aox1 UTSW 1 58085467 missense probably benign
R7876:Aox1 UTSW 1 58062171 nonsense probably null
R7905:Aox1 UTSW 1 58104398 missense possibly damaging 0.72
R7908:Aox1 UTSW 1 58106068 missense possibly damaging 0.68
R8116:Aox1 UTSW 1 58076124 missense probably damaging 1.00
R8179:Aox1 UTSW 1 58097958 missense probably damaging 1.00
R8264:Aox1 UTSW 1 58053714 missense possibly damaging 0.92
R8284:Aox1 UTSW 1 58076091 missense probably damaging 1.00
R8415:Aox1 UTSW 1 58041479 missense probably damaging 1.00
Z1088:Aox1 UTSW 1 58081542 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTTTAGGAAACTCTGGCTGTG -3'
(R):5'- AGCCTTATAGTTTGGGGCAGAG -3'

Sequencing Primer
(F):5'- TGCTGTTAGAGAAGACACACAC -3'
(R):5'- CAGAGGAAGAGAGATGTCTTAGCTC -3'
Posted On2016-06-21