Incidental Mutation 'R5139:Copa'
ID396331
Institutional Source Beutler Lab
Gene Symbol Copa
Ensembl Gene ENSMUSG00000026553
Gene Namecoatomer protein complex subunit alpha
Synonymsxenin
MMRRC Submission 042725-MU
Accession Numbers

Genbank: NM_009938; MGI: 1334462

Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R5139 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location172082529-172122330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 172121329 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 1183 (R1183W)
Ref Sequence ENSEMBL: ENSMUSP00000027833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027833] [ENSMUST00000135192]
Predicted Effect probably damaging
Transcript: ENSMUST00000027833
AA Change: R1183W

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027833
Gene: ENSMUSG00000026553
AA Change: R1183W

DomainStartEndE-ValueType
WD40 2 37 2.86e0 SMART
WD40 40 79 1.11e-6 SMART
WD40 82 121 4.76e-6 SMART
WD40 124 163 2.24e-11 SMART
WD40 194 233 2.98e-7 SMART
WD40 238 277 8.42e-7 SMART
WD40 280 318 1.38e1 SMART
Pfam:Coatomer_WDAD 338 776 5.4e-144 PFAM
Pfam:COPI_C 824 1233 1.4e-190 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122845
Predicted Effect possibly damaging
Transcript: ENSMUST00000135192
AA Change: R1174W

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118179
Gene: ENSMUSG00000026553
AA Change: R1174W

DomainStartEndE-ValueType
WD40 2 37 2.86e0 SMART
WD40 40 79 1.11e-6 SMART
WD40 82 121 4.76e-6 SMART
WD40 124 163 2.24e-11 SMART
WD40 194 233 2.98e-7 SMART
WD40 238 277 8.42e-7 SMART
WD40 280 318 1.38e1 SMART
Pfam:Coatomer_WDAD 338 767 1.1e-148 PFAM
Pfam:COPI_C 815 1224 3.6e-216 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142765
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In eukaryotic cells, protein transport between the endoplasmic reticulum and Golgi compartments is mediated in part by non-clathrin-coated vesicular coat proteins (COPs). Seven coat proteins have been identified, and they represent subunits of a complex known as coatomer. The subunits are designated alpha-COP, beta-COP, beta-prime-COP, gamma-COP, delta-COP, epsilon-COP, and zeta-COP. The alpha-COP, encoded by COPA, shares high sequence similarity with RET1P, the alpha subunit of the coatomer complex in yeast. Also, the N-terminal 25 amino acids of alpha-COP encode the bioactive peptide, xenin, which stimulates exocrine pancreatic secretion and may act as a gastrointestinal hormone. Alternative splicing results in multiple splice forms encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(6) : Gene trapped(6)

 

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,448 L625P probably damaging Het
Agtpbp1 A G 13: 59,500,213 S598P probably damaging Het
Ahnak A C 19: 9,004,655 D1101A probably damaging Het
Aoah T C 13: 21,023,237 V542A possibly damaging Het
Aox1 T C 1: 58,061,297 S418P probably benign Het
Appl1 A G 14: 26,947,155 I354T probably benign Het
BC035947 T C 1: 78,499,247 E216G possibly damaging Het
Bnip3l A G 14: 66,999,615 S63P probably damaging Het
C130060K24Rik A T 6: 65,456,219 N341I probably damaging Het
Cckar T C 5: 53,702,923 N188S probably benign Het
Ccl24 C T 5: 135,572,921 A18T probably benign Het
Cmya5 A G 13: 93,096,061 C840R probably benign Het
Dnah10 T C 5: 124,798,960 V2621A probably damaging Het
Fryl A G 5: 73,090,718 Y1019H probably damaging Het
Hira T C 16: 18,954,758 Y943H probably damaging Het
Ighv3-8 T C 12: 114,322,374 Y116C probably damaging Het
Igkv4-70 G A 6: 69,268,105 T44I probably damaging Het
Lce3c G A 3: 92,945,471 G80S unknown Het
Ldhb A T 6: 142,494,195 N206K probably damaging Het
Mical1 T A 10: 41,478,415 probably null Het
Myh2 T C 11: 67,179,348 L402P probably damaging Het
Naa15 T A 3: 51,443,840 L144I probably damaging Het
Nbea T A 3: 55,626,963 I2918F possibly damaging Het
Olfr1131 C A 2: 87,628,656 H64Q probably benign Het
Pdcd11 C A 19: 47,107,115 S625R probably benign Het
Pdlim7 A G 13: 55,507,056 S214P probably damaging Het
Polg T C 7: 79,450,025 D49G probably damaging Het
Polr2f C A 15: 79,151,658 D106E possibly damaging Het
Ppp6r3 A C 19: 3,464,610 N766K probably damaging Het
Prl8a1 T A 13: 27,574,066 D220V probably damaging Het
Sept9 A G 11: 117,356,685 K497E possibly damaging Het
Sfswap T G 5: 129,571,009 M927R possibly damaging Het
Smad9 T G 3: 54,797,406 W400G possibly damaging Het
St13 G C 15: 81,399,585 R4G probably benign Het
Tcaf3 A G 6: 42,596,933 V115A probably benign Het
Tesmin A G 19: 3,406,934 I238V probably damaging Het
Trf C T 9: 103,222,934 probably null Het
Trpc3 A T 3: 36,671,557 M90K possibly damaging Het
Tshz3 C T 7: 36,771,025 T813I probably benign Het
Tub T A 7: 109,011,102 M1K probably null Het
Wdfy3 A T 5: 101,849,267 probably null Het
Zfp853 T C 5: 143,288,815 Q350R unknown Het
Other mutations in Copa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Copa APN 1 172110688 missense possibly damaging 0.87
IGL01360:Copa APN 1 172087588 unclassified probably null
IGL01434:Copa APN 1 172119561 missense probably benign 0.00
IGL01744:Copa APN 1 172113189 missense probably benign 0.01
IGL01837:Copa APN 1 172118852 missense probably benign 0.01
IGL01988:Copa APN 1 172118264 missense probably benign 0.09
IGL02059:Copa APN 1 172099753 missense probably damaging 0.96
IGL02123:Copa APN 1 172112128 missense probably damaging 1.00
IGL02731:Copa APN 1 172102218 missense possibly damaging 0.77
IGL03114:Copa APN 1 172119268 nonsense probably null
P0027:Copa UTSW 1 172111948 missense possibly damaging 0.87
PIT4434001:Copa UTSW 1 172106175 missense probably benign 0.00
R0233:Copa UTSW 1 172087667 critical splice donor site probably null
R0465:Copa UTSW 1 172118305 missense probably damaging 1.00
R0547:Copa UTSW 1 172121687 splice site probably benign
R0568:Copa UTSW 1 172112137 missense possibly damaging 0.91
R0628:Copa UTSW 1 172091025 splice site probably benign
R1328:Copa UTSW 1 172121691 splice site probably benign
R1494:Copa UTSW 1 172104127 missense probably benign 0.27
R1728:Copa UTSW 1 172111987 missense probably benign
R1758:Copa UTSW 1 172104144 missense probably damaging 1.00
R1784:Copa UTSW 1 172111987 missense probably benign
R1942:Copa UTSW 1 172111888 missense probably damaging 1.00
R2054:Copa UTSW 1 172118957 nonsense probably null
R2299:Copa UTSW 1 172121725 missense probably benign 0.10
R2518:Copa UTSW 1 172119901 missense probably benign
R2680:Copa UTSW 1 172121404 nonsense probably null
R3080:Copa UTSW 1 172113149 missense probably damaging 1.00
R3160:Copa UTSW 1 172091233 missense probably damaging 1.00
R3161:Copa UTSW 1 172091233 missense probably damaging 1.00
R3162:Copa UTSW 1 172091233 missense probably damaging 1.00
R3162:Copa UTSW 1 172091233 missense probably damaging 1.00
R3973:Copa UTSW 1 172121245 missense probably benign 0.00
R3975:Copa UTSW 1 172121245 missense probably benign 0.00
R4031:Copa UTSW 1 172108375 missense probably damaging 1.00
R4155:Copa UTSW 1 172101425 missense probably damaging 1.00
R4227:Copa UTSW 1 172118115 intron probably benign
R4244:Copa UTSW 1 172110718 missense probably benign 0.00
R4254:Copa UTSW 1 172102244 missense probably damaging 1.00
R4291:Copa UTSW 1 172092397 intron probably benign
R4323:Copa UTSW 1 172119264 missense probably damaging 1.00
R4402:Copa UTSW 1 172102224 missense probably damaging 1.00
R4711:Copa UTSW 1 172119988 missense probably damaging 1.00
R4721:Copa UTSW 1 172104274 splice site probably benign
R4773:Copa UTSW 1 172105220 missense probably damaging 1.00
R4794:Copa UTSW 1 172119321 missense probably damaging 1.00
R4887:Copa UTSW 1 172092276 missense probably benign 0.39
R4953:Copa UTSW 1 172082886 unclassified probably benign
R5152:Copa UTSW 1 172118061 missense probably benign 0.34
R5297:Copa UTSW 1 172113108 missense probably damaging 1.00
R5586:Copa UTSW 1 172105222 missense probably damaging 1.00
R5698:Copa UTSW 1 172118944 nonsense probably null
R6283:Copa UTSW 1 172118848 missense possibly damaging 0.79
R6921:Copa UTSW 1 172111924 missense possibly damaging 0.63
R6934:Copa UTSW 1 172110686 missense possibly damaging 0.64
R7009:Copa UTSW 1 172091000 missense probably damaging 0.96
R7194:Copa UTSW 1 172119944 missense probably damaging 0.99
R7348:Copa UTSW 1 172102223 missense possibly damaging 0.96
R7710:Copa UTSW 1 172109844 missense possibly damaging 0.50
R7745:Copa UTSW 1 172111942 missense probably damaging 1.00
R7893:Copa UTSW 1 172119565 nonsense probably null
R7976:Copa UTSW 1 172119565 nonsense probably null
R8168:Copa UTSW 1 172099672 missense probably damaging 1.00
T0722:Copa UTSW 1 172111948 missense possibly damaging 0.87
Z1177:Copa UTSW 1 172106123 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGTGCAGAGGATGGAACCTG -3'
(R):5'- GTGAGAGAACCAGCACCGC -3'

Sequencing Primer
(F):5'- CAGGCTGTCCTAGAACTTGAGATC -3'
(R):5'- GCACCGCGCTTCCTTCTC -3'
Posted On2016-06-21