Incidental Mutation 'R5139:Sfswap'
ID396343
Institutional Source Beutler Lab
Gene Symbol Sfswap
Ensembl Gene ENSMUSG00000029439
Gene Namesplicing factor SWAP
SynonymsSfrs8, 6330437E22Rik, 1190005N23Rik
MMRRC Submission 042725-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5139 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location129501221-129571384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 129571009 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 927 (M927R)
Ref Sequence ENSEMBL: ENSMUSP00000062413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053737] [ENSMUST00000196698]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053737
AA Change: M927R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000062413
Gene: ENSMUSG00000029439
AA Change: M927R

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
DRY_EERY 33 157 1.15e-57 SMART
low complexity region 160 170 N/A INTRINSIC
low complexity region 174 186 N/A INTRINSIC
SWAP 209 262 3.94e-19 SMART
low complexity region 286 293 N/A INTRINSIC
low complexity region 333 352 N/A INTRINSIC
low complexity region 397 441 N/A INTRINSIC
SWAP 456 507 9.55e-18 SMART
low complexity region 513 532 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 598 607 N/A INTRINSIC
coiled coil region 631 686 N/A INTRINSIC
low complexity region 741 788 N/A INTRINSIC
low complexity region 797 821 N/A INTRINSIC
low complexity region 840 865 N/A INTRINSIC
low complexity region 871 888 N/A INTRINSIC
low complexity region 889 905 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195961
Predicted Effect probably benign
Transcript: ENSMUST00000196698
SMART Domains Protein: ENSMUSP00000142464
Gene: ENSMUSG00000029439

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
DRY_EERY 33 121 1.8e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196873
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199925
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a human homolog of Drosophila splicing regulatory protein. This gene autoregulates its expression by control of splicing of its first two introns. In addition, it also regulates the splicing of fibronectin and CD45 genes. Two transcript variants encoding different isoforms have been identified. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit a wobbly phenotype with inner ear defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,448 L625P probably damaging Het
Agtpbp1 A G 13: 59,500,213 S598P probably damaging Het
Ahnak A C 19: 9,004,655 D1101A probably damaging Het
Aoah T C 13: 21,023,237 V542A possibly damaging Het
Aox1 T C 1: 58,061,297 S418P probably benign Het
Appl1 A G 14: 26,947,155 I354T probably benign Het
BC035947 T C 1: 78,499,247 E216G possibly damaging Het
Bnip3l A G 14: 66,999,615 S63P probably damaging Het
C130060K24Rik A T 6: 65,456,219 N341I probably damaging Het
Cckar T C 5: 53,702,923 N188S probably benign Het
Ccl24 C T 5: 135,572,921 A18T probably benign Het
Cmya5 A G 13: 93,096,061 C840R probably benign Het
Copa C T 1: 172,121,329 R1183W probably damaging Het
Dnah10 T C 5: 124,798,960 V2621A probably damaging Het
Fryl A G 5: 73,090,718 Y1019H probably damaging Het
Hira T C 16: 18,954,758 Y943H probably damaging Het
Ighv3-8 T C 12: 114,322,374 Y116C probably damaging Het
Igkv4-70 G A 6: 69,268,105 T44I probably damaging Het
Lce3c G A 3: 92,945,471 G80S unknown Het
Ldhb A T 6: 142,494,195 N206K probably damaging Het
Mical1 T A 10: 41,478,415 probably null Het
Myh2 T C 11: 67,179,348 L402P probably damaging Het
Naa15 T A 3: 51,443,840 L144I probably damaging Het
Nbea T A 3: 55,626,963 I2918F possibly damaging Het
Olfr1131 C A 2: 87,628,656 H64Q probably benign Het
Pdcd11 C A 19: 47,107,115 S625R probably benign Het
Pdlim7 A G 13: 55,507,056 S214P probably damaging Het
Polg T C 7: 79,450,025 D49G probably damaging Het
Polr2f C A 15: 79,151,658 D106E possibly damaging Het
Ppp6r3 A C 19: 3,464,610 N766K probably damaging Het
Prl8a1 T A 13: 27,574,066 D220V probably damaging Het
Sept9 A G 11: 117,356,685 K497E possibly damaging Het
Smad9 T G 3: 54,797,406 W400G possibly damaging Het
St13 G C 15: 81,399,585 R4G probably benign Het
Tcaf3 A G 6: 42,596,933 V115A probably benign Het
Tesmin A G 19: 3,406,934 I238V probably damaging Het
Trf C T 9: 103,222,934 probably null Het
Trpc3 A T 3: 36,671,557 M90K possibly damaging Het
Tshz3 C T 7: 36,771,025 T813I probably benign Het
Tub T A 7: 109,011,102 M1K probably null Het
Wdfy3 A T 5: 101,849,267 probably null Het
Zfp853 T C 5: 143,288,815 Q350R unknown Het
Other mutations in Sfswap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Sfswap APN 5 129513233 missense probably damaging 1.00
IGL02064:Sfswap APN 5 129560796 missense probably benign 0.17
IGL02083:Sfswap APN 5 129539791 missense probably benign
IGL02378:Sfswap APN 5 129539604 missense probably damaging 1.00
FR4340:Sfswap UTSW 5 129569751 unclassified probably benign
FR4342:Sfswap UTSW 5 129569757 unclassified probably benign
FR4449:Sfswap UTSW 5 129569748 unclassified probably benign
FR4449:Sfswap UTSW 5 129569749 unclassified probably benign
FR4548:Sfswap UTSW 5 129569749 unclassified probably benign
FR4548:Sfswap UTSW 5 129569755 unclassified probably benign
FR4737:Sfswap UTSW 5 129569756 unclassified probably benign
FR4976:Sfswap UTSW 5 129569751 unclassified probably benign
I1329:Sfswap UTSW 5 129507137 unclassified probably benign
P0033:Sfswap UTSW 5 129539755 missense possibly damaging 0.60
R0184:Sfswap UTSW 5 129507189 missense probably damaging 0.97
R0233:Sfswap UTSW 5 129554543 missense possibly damaging 0.82
R0233:Sfswap UTSW 5 129554543 missense possibly damaging 0.82
R0414:Sfswap UTSW 5 129504051 missense possibly damaging 0.83
R0415:Sfswap UTSW 5 129504126 missense probably damaging 1.00
R0570:Sfswap UTSW 5 129503978 splice site probably benign
R1018:Sfswap UTSW 5 129554576 missense possibly damaging 0.91
R1173:Sfswap UTSW 5 129507143 critical splice acceptor site probably null
R1298:Sfswap UTSW 5 129541378 missense probably benign 0.14
R1723:Sfswap UTSW 5 129539694 missense probably benign
R1783:Sfswap UTSW 5 129513240 missense possibly damaging 0.92
R1828:Sfswap UTSW 5 129513084 missense probably damaging 1.00
R1879:Sfswap UTSW 5 129541328 missense probably benign 0.01
R2078:Sfswap UTSW 5 129516107 missense possibly damaging 0.81
R2349:Sfswap UTSW 5 129569738 missense possibly damaging 0.87
R3757:Sfswap UTSW 5 129513234 missense probably damaging 1.00
R4093:Sfswap UTSW 5 129560741 missense possibly damaging 0.85
R4094:Sfswap UTSW 5 129560741 missense possibly damaging 0.85
R4095:Sfswap UTSW 5 129560741 missense possibly damaging 0.85
R4785:Sfswap UTSW 5 129513083 missense probably damaging 1.00
R5355:Sfswap UTSW 5 129539746 missense probably benign 0.09
R5481:Sfswap UTSW 5 129514818 missense probably damaging 0.98
R5600:Sfswap UTSW 5 129513158 missense probably damaging 1.00
R5686:Sfswap UTSW 5 129514818 missense probably damaging 0.98
R5906:Sfswap UTSW 5 129542043 missense probably benign 0.22
R6332:Sfswap UTSW 5 129571041 missense possibly damaging 0.91
R6738:Sfswap UTSW 5 129541441 missense probably damaging 0.98
R6743:Sfswap UTSW 5 129550819 nonsense probably null
R7371:Sfswap UTSW 5 129543241 missense probably benign 0.01
R7747:Sfswap UTSW 5 129550593 intron probably null
RF003:Sfswap UTSW 5 129569764 unclassified probably benign
RF042:Sfswap UTSW 5 129569743 unclassified probably benign
RF049:Sfswap UTSW 5 129569744 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTGTACCCTCAGGCCACATG -3'
(R):5'- ATAGCTGCATGTAGGTCGGC -3'

Sequencing Primer
(F):5'- TCAGGCCACATGGGGTCAC -3'
(R):5'- TGCATGTAGGTCGGCAGAGC -3'
Posted On2016-06-21