Incidental Mutation 'R5139:Tesmin'
ID396371
Institutional Source Beutler Lab
Gene Symbol Tesmin
Ensembl Gene ENSMUSG00000024905
Gene Nametestis expressed metallothionein like
SynonymsMtl5, tesmin
MMRRC Submission 042725-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5139 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location3388857-3407823 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3406934 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 238 (I238V)
Ref Sequence ENSEMBL: ENSMUSP00000114171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025840] [ENSMUST00000025842] [ENSMUST00000127142] [ENSMUST00000142193]
Predicted Effect probably damaging
Transcript: ENSMUST00000025840
AA Change: I418V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025840
Gene: ENSMUSG00000024905
AA Change: I418V

DomainStartEndE-ValueType
low complexity region 91 99 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
Blast:CXC 246 287 4e-13 BLAST
CXC 332 373 1.37e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000025842
SMART Domains Protein: ENSMUSP00000025842
Gene: ENSMUSG00000024907

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
Galanin 20 124 3.41e-68 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127142
AA Change: I238V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122687
Gene: ENSMUSG00000024905
AA Change: I238V

DomainStartEndE-ValueType
Blast:CXC 67 107 1e-13 BLAST
CXC 152 193 1.37e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000142193
AA Change: I238V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114171
Gene: ENSMUSG00000024905
AA Change: I238V

DomainStartEndE-ValueType
Blast:CXC 67 107 1e-13 BLAST
CXC 152 193 1.37e-17 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Metallothionein proteins are highly conserved low-molecular-weight cysteine-rich proteins that are induced by and bind to heavy metal ions and have no enzymatic activity. They may play a central role in the regulation of cell growth and differentiation and are involved in spermatogenesis. This gene encodes a metallothionein-like protein which has been shown to be expressed differentially in mouse testis and ovary. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,448 L625P probably damaging Het
Agtpbp1 A G 13: 59,500,213 S598P probably damaging Het
Ahnak A C 19: 9,004,655 D1101A probably damaging Het
Aoah T C 13: 21,023,237 V542A possibly damaging Het
Aox1 T C 1: 58,061,297 S418P probably benign Het
Appl1 A G 14: 26,947,155 I354T probably benign Het
BC035947 T C 1: 78,499,247 E216G possibly damaging Het
Bnip3l A G 14: 66,999,615 S63P probably damaging Het
C130060K24Rik A T 6: 65,456,219 N341I probably damaging Het
Cckar T C 5: 53,702,923 N188S probably benign Het
Ccl24 C T 5: 135,572,921 A18T probably benign Het
Cmya5 A G 13: 93,096,061 C840R probably benign Het
Copa C T 1: 172,121,329 R1183W probably damaging Het
Dnah10 T C 5: 124,798,960 V2621A probably damaging Het
Fryl A G 5: 73,090,718 Y1019H probably damaging Het
Hira T C 16: 18,954,758 Y943H probably damaging Het
Ighv3-8 T C 12: 114,322,374 Y116C probably damaging Het
Igkv4-70 G A 6: 69,268,105 T44I probably damaging Het
Lce3c G A 3: 92,945,471 G80S unknown Het
Ldhb A T 6: 142,494,195 N206K probably damaging Het
Mical1 T A 10: 41,478,415 probably null Het
Myh2 T C 11: 67,179,348 L402P probably damaging Het
Naa15 T A 3: 51,443,840 L144I probably damaging Het
Nbea T A 3: 55,626,963 I2918F possibly damaging Het
Olfr1131 C A 2: 87,628,656 H64Q probably benign Het
Pdcd11 C A 19: 47,107,115 S625R probably benign Het
Pdlim7 A G 13: 55,507,056 S214P probably damaging Het
Polg T C 7: 79,450,025 D49G probably damaging Het
Polr2f C A 15: 79,151,658 D106E possibly damaging Het
Ppp6r3 A C 19: 3,464,610 N766K probably damaging Het
Prl8a1 T A 13: 27,574,066 D220V probably damaging Het
Sept9 A G 11: 117,356,685 K497E possibly damaging Het
Sfswap T G 5: 129,571,009 M927R possibly damaging Het
Smad9 T G 3: 54,797,406 W400G possibly damaging Het
St13 G C 15: 81,399,585 R4G probably benign Het
Tcaf3 A G 6: 42,596,933 V115A probably benign Het
Trf C T 9: 103,222,934 probably null Het
Trpc3 A T 3: 36,671,557 M90K possibly damaging Het
Tshz3 C T 7: 36,771,025 T813I probably benign Het
Tub T A 7: 109,011,102 M1K probably null Het
Wdfy3 A T 5: 101,849,267 probably null Het
Zfp853 T C 5: 143,288,815 Q350R unknown Het
Other mutations in Tesmin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02552:Tesmin APN 19 3402483 unclassified probably benign
R0207:Tesmin UTSW 19 3404088 missense probably benign 0.00
R2441:Tesmin UTSW 19 3402577 critical splice donor site probably null
R5272:Tesmin UTSW 19 3406992 missense probably damaging 1.00
R6077:Tesmin UTSW 19 3389260 missense possibly damaging 0.49
R7246:Tesmin UTSW 19 3406965 missense probably damaging 1.00
R7357:Tesmin UTSW 19 3397042 missense probably benign 0.04
R7567:Tesmin UTSW 19 3392218 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGACATACATAGCTCCTTTCCC -3'
(R):5'- CAATTTTCAGCCCCTTGGAC -3'

Sequencing Primer
(F):5'- CTACCAAGCTTTCCTGAGAGAGG -3'
(R):5'- ACTTGAACTCGATGTGGAGAATCTG -3'
Posted On2016-06-21