Incidental Mutation 'R5140:Ube3c'
ID396389
Institutional Source Beutler Lab
Gene Symbol Ube3c
Ensembl Gene ENSMUSG00000039000
Gene Nameubiquitin protein ligase E3C
Synonyms
MMRRC Submission 042726-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5140 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location29569242-29676092 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29635711 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 695 (F695I)
Ref Sequence ENSEMBL: ENSMUSP00000045998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049453] [ENSMUST00000199032]
Predicted Effect probably damaging
Transcript: ENSMUST00000049453
AA Change: F695I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045998
Gene: ENSMUSG00000039000
AA Change: F695I

DomainStartEndE-ValueType
IQ 44 66 1.68e-3 SMART
low complexity region 363 376 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
Blast:HECTc 645 701 5e-25 BLAST
HECTc 742 1083 8.54e-178 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199032
SMART Domains Protein: ENSMUSP00000142474
Gene: ENSMUSG00000039000

DomainStartEndE-ValueType
IQ 44 66 8e-6 SMART
low complexity region 363 376 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199598
Meta Mutation Damage Score 0.9236 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,702,154 I405N probably damaging Het
Abhd17b T C 19: 21,684,181 L244P probably damaging Het
Aebp2 T A 6: 140,633,806 C34* probably null Het
Arhgap33 A G 7: 30,528,301 V491A probably damaging Het
Cacul1 C T 19: 60,563,181 R201Q probably benign Het
Cald1 T A 6: 34,753,580 N77K probably damaging Het
Clcn6 A C 4: 148,038,317 probably benign Het
Copb1 A T 7: 114,246,800 H178Q probably benign Het
Dnah17 C T 11: 118,086,945 V1854I probably damaging Het
Dnajc16 T G 4: 141,764,683 T610P possibly damaging Het
Enpp1 T C 10: 24,652,852 N624S possibly damaging Het
F2 CAGAAAG CAG 2: 91,634,957 probably benign Het
Foxn1 T C 11: 78,361,633 T310A probably benign Het
Galnt16 T A 12: 80,581,299 D256E possibly damaging Het
Gbp11 T C 5: 105,331,053 D173G probably damaging Het
Glmn A G 5: 107,570,200 S284P probably damaging Het
Gm3985 A G 8: 32,890,665 noncoding transcript Het
Hs3st6 A T 17: 24,758,547 M334L probably benign Het
Idua T A 5: 108,680,314 D155E probably damaging Het
Kdm6b T C 11: 69,400,055 probably benign Het
Kiss1r T C 10: 79,921,627 F272L probably damaging Het
Krt35 T C 11: 100,094,517 K233E probably damaging Het
Krt36 C T 11: 100,103,502 V250M probably damaging Het
Lhpp T C 7: 132,705,632 Y253H probably damaging Het
Npas3 T A 12: 53,501,114 L51* probably null Het
Olfr1224-ps1 T C 2: 89,157,107 K23E probably benign Het
Olfr1247 T C 2: 89,609,283 Y273C probably damaging Het
Olfr347 T A 2: 36,734,498 M59K possibly damaging Het
Olfr455 T C 6: 42,538,515 H169R probably benign Het
Olfr661 T C 7: 104,688,900 M295T probably benign Het
Pcdhb9 T G 18: 37,401,133 V60G probably benign Het
Prkce T C 17: 86,482,142 V239A probably benign Het
Ralgapa1 C T 12: 55,665,674 R1804Q probably damaging Het
Ralgapa1 C T 12: 55,776,152 C293Y probably damaging Het
Rnf26 C A 9: 44,112,774 probably null Het
Safb2 T C 17: 56,577,901 D178G probably benign Het
Scn9a C T 2: 66,565,167 V178M possibly damaging Het
Sergef A G 7: 46,635,602 probably benign Het
Serpinb9 G A 13: 33,006,561 G7R probably benign Het
Setd2 C A 9: 110,551,129 D1337E probably benign Het
Shprh T A 10: 11,154,705 M222K probably benign Het
Slc25a40 T C 5: 8,430,486 Y79H probably damaging Het
Slc41a2 A G 10: 83,297,291 M297T probably damaging Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Spcs1 A G 14: 31,000,613 L83S probably benign Het
Sult1c1 T C 17: 53,969,715 N106S probably benign Het
Szt2 C T 4: 118,386,981 R1309Q possibly damaging Het
Uimc1 A G 13: 55,075,517 L314P probably damaging Het
Usp17le C T 7: 104,769,438 E166K probably damaging Het
Vmn2r92 G A 17: 18,152,050 D41N probably benign Het
Other mutations in Ube3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Ube3c APN 5 29619229 missense probably damaging 1.00
IGL01526:Ube3c APN 5 29667962 missense probably damaging 0.99
IGL01901:Ube3c APN 5 29668007 missense probably damaging 1.00
IGL02029:Ube3c APN 5 29619328 missense probably damaging 1.00
IGL02893:Ube3c APN 5 29632763 missense probably damaging 1.00
IGL03400:Ube3c APN 5 29601347 missense probably benign 0.00
lord_business UTSW 5 29637586 splice site probably benign
R0067:Ube3c UTSW 5 29598938 missense possibly damaging 0.94
R0067:Ube3c UTSW 5 29598938 missense possibly damaging 0.94
R0099:Ube3c UTSW 5 29607064 missense probably damaging 1.00
R0606:Ube3c UTSW 5 29590928 missense probably damaging 1.00
R0755:Ube3c UTSW 5 29637742 missense probably damaging 1.00
R0900:Ube3c UTSW 5 29601346 missense probably benign 0.00
R1624:Ube3c UTSW 5 29646619 missense probably benign 0.00
R1701:Ube3c UTSW 5 29601202 missense probably benign
R1918:Ube3c UTSW 5 29587317 missense probably damaging 1.00
R1933:Ube3c UTSW 5 29619659 missense probably damaging 0.97
R2072:Ube3c UTSW 5 29635640 missense probably benign 0.02
R2095:Ube3c UTSW 5 29668040 missense probably damaging 1.00
R2122:Ube3c UTSW 5 29619606 missense probably benign 0.14
R2962:Ube3c UTSW 5 29658418 missense possibly damaging 0.81
R3605:Ube3c UTSW 5 29598938 missense possibly damaging 0.94
R3606:Ube3c UTSW 5 29598938 missense possibly damaging 0.94
R3764:Ube3c UTSW 5 29637586 splice site probably benign
R3940:Ube3c UTSW 5 29619360 missense probably benign 0.31
R4776:Ube3c UTSW 5 29632838 critical splice donor site probably null
R4794:Ube3c UTSW 5 29597085 missense probably benign 0.06
R4924:Ube3c UTSW 5 29631271 missense possibly damaging 0.56
R5059:Ube3c UTSW 5 29631295 missense probably null 0.11
R5068:Ube3c UTSW 5 29601354 critical splice donor site probably null
R5849:Ube3c UTSW 5 29658409 missense probably damaging 1.00
R5890:Ube3c UTSW 5 29658292 missense possibly damaging 0.77
R5956:Ube3c UTSW 5 29599056 intron probably benign
R6035:Ube3c UTSW 5 29601163 missense probably benign 0.00
R6035:Ube3c UTSW 5 29601163 missense probably benign 0.00
R6264:Ube3c UTSW 5 29590831 missense probably damaging 1.00
R6354:Ube3c UTSW 5 29663583 missense probably damaging 0.99
R6658:Ube3c UTSW 5 29602217 missense probably damaging 1.00
R6877:Ube3c UTSW 5 29587318 missense probably benign 0.22
R7584:Ube3c UTSW 5 29637629 critical splice acceptor site probably benign
R7660:Ube3c UTSW 5 29619631 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCCAGAGGATGTGTTCATGG -3'
(R):5'- AATCTCTAGTCTAACAGGCTGC -3'

Sequencing Primer
(F):5'- CCCAGAGGATGTGTTCATGGAAATAG -3'
(R):5'- AGTCTAACAGGCTGCTTAGC -3'
Posted On2016-06-21