Incidental Mutation 'R5140:Enpp1'
ID 396407
Institutional Source Beutler Lab
Gene Symbol Enpp1
Ensembl Gene ENSMUSG00000037370
Gene Name ectonucleotide pyrophosphatase/phosphodiesterase 1
Synonyms PC-1, Npps, E-NPP1, Pca-1, twy, NPP1, 4833416E15Rik, Pdnp1, Pca, CD203c, Ly-41
MMRRC Submission 042726-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock # R5140 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 24637914-24712159 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 24652852 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 624 (N624S)
Ref Sequence ENSEMBL: ENSMUSP00000101159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039882] [ENSMUST00000105520] [ENSMUST00000135846]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039882
SMART Domains Protein: ENSMUSP00000046090
Gene: ENSMUSG00000037370

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
low complexity region 59 69 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 358 1e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105520
AA Change: N624S

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101159
Gene: ENSMUSG00000037370
AA Change: N624S

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 1.8e-87 PFAM
Endonuclease_NS 655 873 5.33e-15 SMART
NUC 656 887 3.62e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135846
AA Change: N624S

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000114273
Gene: ENSMUSG00000037370
AA Change: N624S

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 4.2e-91 PFAM
Endonuclease_NS 656 874 5.33e-15 SMART
NUC 657 888 3.62e-107 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150570
Meta Mutation Damage Score 0.0944 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: This gene encodes a member of the nucleoside pyrophosphatase/phosphodiesterase family of enzymes that catalyzes the hydrolysis of pyrophosphate and phosphodiester bonds in nucleotide triphosphates and oligonucleotides, respectively, to generate nucleoside 5'-monophosphates. The encoded protein is a type II transmembrane glycoprotein that negatively regulates bone mineralization. Mice harboring a nonsense mutation in this gene, termed tiptoe walking (ttw), exhibit ectopic ossification of the spinal ligaments. The encoded protein binds to the insulin receptor, inhibits downstream signaling events and induces insulin resistance and glucose tolerance. This gene is located adjacent to a paralog on chromosome 10. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele develop hyperostosis leading to ossific intervertebral fusion, peripheral joint ankylosis and tendon calcification, and display spontaneous arterial and articular cartilage calcification, and altered adipocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,702,154 I405N probably damaging Het
Abhd17b T C 19: 21,684,181 L244P probably damaging Het
Aebp2 T A 6: 140,633,806 C34* probably null Het
Arhgap33 A G 7: 30,528,301 V491A probably damaging Het
Cacul1 C T 19: 60,563,181 R201Q probably benign Het
Cald1 T A 6: 34,753,580 N77K probably damaging Het
Clcn6 A C 4: 148,038,317 probably benign Het
Copb1 A T 7: 114,246,800 H178Q probably benign Het
Dnah17 C T 11: 118,086,945 V1854I probably damaging Het
Dnajc16 T G 4: 141,764,683 T610P possibly damaging Het
F2 CAGAAAG CAG 2: 91,634,957 probably benign Het
Foxn1 T C 11: 78,361,633 T310A probably benign Het
Galnt16 T A 12: 80,581,299 D256E possibly damaging Het
Gbp11 T C 5: 105,331,053 D173G probably damaging Het
Glmn A G 5: 107,570,200 S284P probably damaging Het
Gm3985 A G 8: 32,890,665 noncoding transcript Het
Hs3st6 A T 17: 24,758,547 M334L probably benign Het
Idua T A 5: 108,680,314 D155E probably damaging Het
Kdm6b T C 11: 69,400,055 probably benign Het
Kiss1r T C 10: 79,921,627 F272L probably damaging Het
Krt35 T C 11: 100,094,517 K233E probably damaging Het
Krt36 C T 11: 100,103,502 V250M probably damaging Het
Lhpp T C 7: 132,705,632 Y253H probably damaging Het
Npas3 T A 12: 53,501,114 L51* probably null Het
Olfr1224-ps1 T C 2: 89,157,107 K23E probably benign Het
Olfr1247 T C 2: 89,609,283 Y273C probably damaging Het
Olfr347 T A 2: 36,734,498 M59K possibly damaging Het
Olfr455 T C 6: 42,538,515 H169R probably benign Het
Olfr661 T C 7: 104,688,900 M295T probably benign Het
Pcdhb9 T G 18: 37,401,133 V60G probably benign Het
Prkce T C 17: 86,482,142 V239A probably benign Het
Ralgapa1 C T 12: 55,665,674 R1804Q probably damaging Het
Ralgapa1 C T 12: 55,776,152 C293Y probably damaging Het
Rnf26 C A 9: 44,112,774 probably null Het
Safb2 T C 17: 56,577,901 D178G probably benign Het
Scn9a C T 2: 66,565,167 V178M possibly damaging Het
Sergef A G 7: 46,635,602 probably benign Het
Serpinb9 G A 13: 33,006,561 G7R probably benign Het
Setd2 C A 9: 110,551,129 D1337E probably benign Het
Shprh T A 10: 11,154,705 M222K probably benign Het
Slc25a40 T C 5: 8,430,486 Y79H probably damaging Het
Slc41a2 A G 10: 83,297,291 M297T probably damaging Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Spcs1 A G 14: 31,000,613 L83S probably benign Het
Sult1c1 T C 17: 53,969,715 N106S probably benign Het
Szt2 C T 4: 118,386,981 R1309Q possibly damaging Het
Ube3c T A 5: 29,635,711 F695I probably damaging Het
Uimc1 A G 13: 55,075,517 L314P probably damaging Het
Usp17le C T 7: 104,769,438 E166K probably damaging Het
Vmn2r92 G A 17: 18,152,050 D41N probably benign Het
Other mutations in Enpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Enpp1 APN 10 24645427 missense possibly damaging 0.93
IGL00966:Enpp1 APN 10 24654031 missense probably damaging 1.00
IGL01364:Enpp1 APN 10 24664614 missense probably damaging 1.00
IGL02040:Enpp1 APN 10 24655856 missense probably damaging 1.00
IGL02143:Enpp1 APN 10 24677974 missense probably damaging 1.00
IGL02631:Enpp1 APN 10 24641961 missense probably damaging 1.00
IGL02655:Enpp1 APN 10 24677974 missense probably damaging 1.00
IGL02677:Enpp1 APN 10 24679185 splice site probably benign
IGL02691:Enpp1 APN 10 24711892 missense probably damaging 0.99
IGL02966:Enpp1 APN 10 24660274 missense probably damaging 1.00
IGL03087:Enpp1 APN 10 24655881 splice site probably benign
IGL03330:Enpp1 APN 10 24664906 splice site probably benign
IGL03365:Enpp1 APN 10 24669025 missense probably damaging 1.00
IGL03377:Enpp1 APN 10 24660283 critical splice acceptor site probably null
PIT4651001:Enpp1 UTSW 10 24653950 missense probably benign 0.16
R0011:Enpp1 UTSW 10 24670002 nonsense probably null
R0201:Enpp1 UTSW 10 24653917 missense probably benign 0.00
R0496:Enpp1 UTSW 10 24672052 missense probably benign 0.18
R1228:Enpp1 UTSW 10 24645412 missense probably benign 0.30
R1536:Enpp1 UTSW 10 24641834 missense probably benign 0.27
R1927:Enpp1 UTSW 10 24654888 missense possibly damaging 0.65
R2051:Enpp1 UTSW 10 24711804 critical splice donor site probably null
R2057:Enpp1 UTSW 10 24660192 missense probably damaging 0.98
R2353:Enpp1 UTSW 10 24651341 missense probably benign 0.24
R4077:Enpp1 UTSW 10 24669007 critical splice donor site probably null
R4079:Enpp1 UTSW 10 24669007 critical splice donor site probably null
R4739:Enpp1 UTSW 10 24679248 missense probably null 0.99
R4740:Enpp1 UTSW 10 24679248 missense probably null 0.99
R4761:Enpp1 UTSW 10 24641951 missense possibly damaging 0.94
R4822:Enpp1 UTSW 10 24661935 missense possibly damaging 0.74
R4919:Enpp1 UTSW 10 24648085 missense probably benign 0.01
R5302:Enpp1 UTSW 10 24651390 missense probably benign
R5421:Enpp1 UTSW 10 24669757 missense probably damaging 1.00
R5695:Enpp1 UTSW 10 24654908 missense probably damaging 0.99
R5735:Enpp1 UTSW 10 24654919 missense possibly damaging 0.92
R5789:Enpp1 UTSW 10 24647239 missense probably benign
R5942:Enpp1 UTSW 10 24676068 nonsense probably null
R6048:Enpp1 UTSW 10 24660254 missense probably damaging 1.00
R6053:Enpp1 UTSW 10 24657126 missense possibly damaging 0.93
R6305:Enpp1 UTSW 10 24641882 missense probably damaging 1.00
R6319:Enpp1 UTSW 10 24648031 missense probably damaging 1.00
R6624:Enpp1 UTSW 10 24669755 nonsense probably null
R6793:Enpp1 UTSW 10 24655825 missense probably damaging 1.00
R6936:Enpp1 UTSW 10 24651339 missense probably benign 0.30
R7255:Enpp1 UTSW 10 24645315 missense possibly damaging 0.95
R7285:Enpp1 UTSW 10 24660161 missense probably benign 0.01
R7401:Enpp1 UTSW 10 24645282 missense probably damaging 1.00
R7429:Enpp1 UTSW 10 24711950 missense probably benign 0.00
R7430:Enpp1 UTSW 10 24711950 missense probably benign 0.00
R7526:Enpp1 UTSW 10 24674410 splice site probably null
R7532:Enpp1 UTSW 10 24675987 missense probably benign 0.29
R7789:Enpp1 UTSW 10 24654083 splice site probably null
R8073:Enpp1 UTSW 10 24679244 missense possibly damaging 0.50
R8283:Enpp1 UTSW 10 24674656 missense probably benign 0.25
R8955:Enpp1 UTSW 10 24669028 missense probably benign 0.01
R9494:Enpp1 UTSW 10 24651336 missense probably benign
Z1177:Enpp1 UTSW 10 24661942 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACCAGCATGTATACCTTTTCAGTG -3'
(R):5'- CCCCACCTTGTCAAAGAAGG -3'

Sequencing Primer
(F):5'- CCTTTTCAGTGTAAGTTTCTAGCATG -3'
(R):5'- TTGTCAAAGAAGGAAAACATCTCC -3'
Posted On 2016-06-21