Incidental Mutation 'R5140:Slc41a2'
ID396409
Institutional Source Beutler Lab
Gene Symbol Slc41a2
Ensembl Gene ENSMUSG00000034591
Gene Namesolute carrier family 41, member 2
SynonymsA230035L05Rik
MMRRC Submission 042726-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R5140 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location83230848-83337882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83297291 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 297 (M297T)
Ref Sequence ENSEMBL: ENSMUSP00000036690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039956]
Predicted Effect probably damaging
Transcript: ENSMUST00000039956
AA Change: M297T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036690
Gene: ENSMUSG00000034591
AA Change: M297T

DomainStartEndE-ValueType
transmembrane domain 159 181 N/A INTRINSIC
Pfam:MgtE 200 334 8.7e-24 PFAM
transmembrane domain 346 368 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
Pfam:MgtE 414 557 2.9e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139329
Meta Mutation Damage Score 0.2489 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,702,154 I405N probably damaging Het
Abhd17b T C 19: 21,684,181 L244P probably damaging Het
Aebp2 T A 6: 140,633,806 C34* probably null Het
Arhgap33 A G 7: 30,528,301 V491A probably damaging Het
Cacul1 C T 19: 60,563,181 R201Q probably benign Het
Cald1 T A 6: 34,753,580 N77K probably damaging Het
Clcn6 A C 4: 148,038,317 probably benign Het
Copb1 A T 7: 114,246,800 H178Q probably benign Het
Dnah17 C T 11: 118,086,945 V1854I probably damaging Het
Dnajc16 T G 4: 141,764,683 T610P possibly damaging Het
Enpp1 T C 10: 24,652,852 N624S possibly damaging Het
F2 CAGAAAG CAG 2: 91,634,957 probably benign Het
Foxn1 T C 11: 78,361,633 T310A probably benign Het
Galnt16 T A 12: 80,581,299 D256E possibly damaging Het
Gbp11 T C 5: 105,331,053 D173G probably damaging Het
Glmn A G 5: 107,570,200 S284P probably damaging Het
Gm3985 A G 8: 32,890,665 noncoding transcript Het
Hs3st6 A T 17: 24,758,547 M334L probably benign Het
Idua T A 5: 108,680,314 D155E probably damaging Het
Kdm6b T C 11: 69,400,055 probably benign Het
Kiss1r T C 10: 79,921,627 F272L probably damaging Het
Krt35 T C 11: 100,094,517 K233E probably damaging Het
Krt36 C T 11: 100,103,502 V250M probably damaging Het
Lhpp T C 7: 132,705,632 Y253H probably damaging Het
Npas3 T A 12: 53,501,114 L51* probably null Het
Olfr1224-ps1 T C 2: 89,157,107 K23E probably benign Het
Olfr1247 T C 2: 89,609,283 Y273C probably damaging Het
Olfr347 T A 2: 36,734,498 M59K possibly damaging Het
Olfr455 T C 6: 42,538,515 H169R probably benign Het
Olfr661 T C 7: 104,688,900 M295T probably benign Het
Pcdhb9 T G 18: 37,401,133 V60G probably benign Het
Prkce T C 17: 86,482,142 V239A probably benign Het
Ralgapa1 C T 12: 55,665,674 R1804Q probably damaging Het
Ralgapa1 C T 12: 55,776,152 C293Y probably damaging Het
Rnf26 C A 9: 44,112,774 probably null Het
Safb2 T C 17: 56,577,901 D178G probably benign Het
Scn9a C T 2: 66,565,167 V178M possibly damaging Het
Sergef A G 7: 46,635,602 probably benign Het
Serpinb9 G A 13: 33,006,561 G7R probably benign Het
Setd2 C A 9: 110,551,129 D1337E probably benign Het
Shprh T A 10: 11,154,705 M222K probably benign Het
Slc25a40 T C 5: 8,430,486 Y79H probably damaging Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Spcs1 A G 14: 31,000,613 L83S probably benign Het
Sult1c1 T C 17: 53,969,715 N106S probably benign Het
Szt2 C T 4: 118,386,981 R1309Q possibly damaging Het
Ube3c T A 5: 29,635,711 F695I probably damaging Het
Uimc1 A G 13: 55,075,517 L314P probably damaging Het
Usp17le C T 7: 104,769,438 E166K probably damaging Het
Vmn2r92 G A 17: 18,152,050 D41N probably benign Het
Other mutations in Slc41a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Slc41a2 APN 10 83313530 unclassified probably benign
IGL02263:Slc41a2 APN 10 83313500 missense possibly damaging 0.82
IGL02338:Slc41a2 APN 10 83316591 missense possibly damaging 0.68
IGL02680:Slc41a2 APN 10 83283864 missense probably benign 0.20
IGL02703:Slc41a2 APN 10 83254847 missense probably damaging 1.00
IGL03039:Slc41a2 APN 10 83283858 missense probably benign 0.37
PIT4508001:Slc41a2 UTSW 10 83254880 missense probably damaging 0.99
R0326:Slc41a2 UTSW 10 83283746 missense probably damaging 1.00
R0470:Slc41a2 UTSW 10 83316222 missense possibly damaging 0.94
R0610:Slc41a2 UTSW 10 83283728 missense possibly damaging 0.75
R1708:Slc41a2 UTSW 10 83233732 missense probably damaging 1.00
R1765:Slc41a2 UTSW 10 83301266 missense probably damaging 1.00
R1870:Slc41a2 UTSW 10 83301165 nonsense probably null
R1875:Slc41a2 UTSW 10 83256085 missense probably damaging 1.00
R2008:Slc41a2 UTSW 10 83304303 critical splice donor site probably null
R2172:Slc41a2 UTSW 10 83283774 missense probably benign 0.00
R4193:Slc41a2 UTSW 10 83301221 missense probably damaging 0.97
R4789:Slc41a2 UTSW 10 83316456 missense probably damaging 1.00
R4861:Slc41a2 UTSW 10 83316458 missense probably damaging 0.99
R4861:Slc41a2 UTSW 10 83316458 missense probably damaging 0.99
R4913:Slc41a2 UTSW 10 83313420 missense probably damaging 1.00
R5012:Slc41a2 UTSW 10 83301263 missense probably benign 0.02
R5189:Slc41a2 UTSW 10 83313411 splice site probably null
R5410:Slc41a2 UTSW 10 83281368 critical splice donor site probably null
R5748:Slc41a2 UTSW 10 83297159 missense probably benign 0.00
R5808:Slc41a2 UTSW 10 83313498 missense probably benign 0.29
R6124:Slc41a2 UTSW 10 83297252 missense probably damaging 1.00
R6292:Slc41a2 UTSW 10 83254926 missense probably damaging 0.99
R6511:Slc41a2 UTSW 10 83283788 missense probably damaging 0.99
R6793:Slc41a2 UTSW 10 83301158 splice site probably null
R6970:Slc41a2 UTSW 10 83316096 missense possibly damaging 0.53
R7584:Slc41a2 UTSW 10 83316789 splice site probably benign
R7752:Slc41a2 UTSW 10 83256041 missense possibly damaging 0.73
R8289:Slc41a2 UTSW 10 83301180 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGACTCTGAATAATGCCATGTTCAG -3'
(R):5'- CAACATTGAATCAGTATGTCCTGTG -3'

Sequencing Primer
(F):5'- CCATGTTCAGTTTCAGGGAAC -3'
(R):5'- ATAGTTTGTGGAAGGGCATTTTGC -3'
Posted On2016-06-21