Incidental Mutation 'R5140:Krt36'
ID396412
Institutional Source Beutler Lab
Gene Symbol Krt36
Ensembl Gene ENSMUSG00000020916
Gene Namekeratin 36
SynonymsKrt1-22, keratin 5, HRa-1, Krt1-5
MMRRC Submission 042726-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5140 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100102007-100105626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100103502 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 250 (V250M)
Ref Sequence ENSEMBL: ENSMUSP00000103039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107416]
Predicted Effect probably damaging
Transcript: ENSMUST00000107416
AA Change: V250M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103039
Gene: ENSMUSG00000020916
AA Change: V250M

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Filament 92 403 4.05e-163 SMART
low complexity region 425 443 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127883
Meta Mutation Damage Score 0.1364 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. This type I hair keratin is an acidic protein which heterodimerizes with type II keratins to form hair and nails. The type I hair keratins are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hyperkeratosis affecting the scales of the tail skin and the filiform papillae of the tongue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,702,154 I405N probably damaging Het
Abhd17b T C 19: 21,684,181 L244P probably damaging Het
Aebp2 T A 6: 140,633,806 C34* probably null Het
Arhgap33 A G 7: 30,528,301 V491A probably damaging Het
Cacul1 C T 19: 60,563,181 R201Q probably benign Het
Cald1 T A 6: 34,753,580 N77K probably damaging Het
Clcn6 A C 4: 148,038,317 probably benign Het
Copb1 A T 7: 114,246,800 H178Q probably benign Het
Dnah17 C T 11: 118,086,945 V1854I probably damaging Het
Dnajc16 T G 4: 141,764,683 T610P possibly damaging Het
Enpp1 T C 10: 24,652,852 N624S possibly damaging Het
F2 CAGAAAG CAG 2: 91,634,957 probably benign Het
Foxn1 T C 11: 78,361,633 T310A probably benign Het
Galnt16 T A 12: 80,581,299 D256E possibly damaging Het
Gbp11 T C 5: 105,331,053 D173G probably damaging Het
Glmn A G 5: 107,570,200 S284P probably damaging Het
Gm3985 A G 8: 32,890,665 noncoding transcript Het
Hs3st6 A T 17: 24,758,547 M334L probably benign Het
Idua T A 5: 108,680,314 D155E probably damaging Het
Kdm6b T C 11: 69,400,055 probably benign Het
Kiss1r T C 10: 79,921,627 F272L probably damaging Het
Krt35 T C 11: 100,094,517 K233E probably damaging Het
Lhpp T C 7: 132,705,632 Y253H probably damaging Het
Npas3 T A 12: 53,501,114 L51* probably null Het
Olfr1224-ps1 T C 2: 89,157,107 K23E probably benign Het
Olfr1247 T C 2: 89,609,283 Y273C probably damaging Het
Olfr347 T A 2: 36,734,498 M59K possibly damaging Het
Olfr455 T C 6: 42,538,515 H169R probably benign Het
Olfr661 T C 7: 104,688,900 M295T probably benign Het
Pcdhb9 T G 18: 37,401,133 V60G probably benign Het
Prkce T C 17: 86,482,142 V239A probably benign Het
Ralgapa1 C T 12: 55,665,674 R1804Q probably damaging Het
Ralgapa1 C T 12: 55,776,152 C293Y probably damaging Het
Rnf26 C A 9: 44,112,774 probably null Het
Safb2 T C 17: 56,577,901 D178G probably benign Het
Scn9a C T 2: 66,565,167 V178M possibly damaging Het
Sergef A G 7: 46,635,602 probably benign Het
Serpinb9 G A 13: 33,006,561 G7R probably benign Het
Setd2 C A 9: 110,551,129 D1337E probably benign Het
Shprh T A 10: 11,154,705 M222K probably benign Het
Slc25a40 T C 5: 8,430,486 Y79H probably damaging Het
Slc41a2 A G 10: 83,297,291 M297T probably damaging Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Spcs1 A G 14: 31,000,613 L83S probably benign Het
Sult1c1 T C 17: 53,969,715 N106S probably benign Het
Szt2 C T 4: 118,386,981 R1309Q possibly damaging Het
Ube3c T A 5: 29,635,711 F695I probably damaging Het
Uimc1 A G 13: 55,075,517 L314P probably damaging Het
Usp17le C T 7: 104,769,438 E166K probably damaging Het
Vmn2r92 G A 17: 18,152,050 D41N probably benign Het
Other mutations in Krt36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Krt36 APN 11 100102948 missense probably damaging 0.98
IGL01737:Krt36 APN 11 100104120 missense possibly damaging 0.62
IGL02388:Krt36 APN 11 100105164 nonsense probably null
IGL02985:Krt36 APN 11 100103179 missense probably benign 0.32
R0393:Krt36 UTSW 11 100104114 missense possibly damaging 0.91
R0617:Krt36 UTSW 11 100102275 missense probably damaging 1.00
R0930:Krt36 UTSW 11 100103399 missense probably damaging 1.00
R1166:Krt36 UTSW 11 100102828 missense probably benign 0.00
R1201:Krt36 UTSW 11 100104057 missense probably benign 0.22
R1587:Krt36 UTSW 11 100102302 missense probably damaging 1.00
R1750:Krt36 UTSW 11 100104058 missense probably benign 0.00
R1826:Krt36 UTSW 11 100103030 splice site probably benign
R1846:Krt36 UTSW 11 100105548 missense probably damaging 1.00
R2208:Krt36 UTSW 11 100102939 missense probably damaging 0.96
R4303:Krt36 UTSW 11 100103413 missense possibly damaging 0.59
R5719:Krt36 UTSW 11 100104161 missense possibly damaging 0.95
R5944:Krt36 UTSW 11 100105313 missense probably benign
R6188:Krt36 UTSW 11 100102420 missense probably benign 0.00
R6271:Krt36 UTSW 11 100104472 nonsense probably null
R6809:Krt36 UTSW 11 100105509 missense probably benign 0.00
R6856:Krt36 UTSW 11 100103390 missense probably damaging 1.00
R7153:Krt36 UTSW 11 100105146 nonsense probably null
R7602:Krt36 UTSW 11 100102960 missense probably benign 0.00
R7822:Krt36 UTSW 11 100104140 missense possibly damaging 0.86
R7894:Krt36 UTSW 11 100105235 missense probably damaging 1.00
R7977:Krt36 UTSW 11 100105235 missense probably damaging 1.00
Z1088:Krt36 UTSW 11 100104189 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTCAGCTCCTCGGTCTACAGAG -3'
(R):5'- GCATGTTCAAAGAGGTCAGC -3'

Sequencing Primer
(F):5'- CTCCTCGGTCTACAGAGAAGGAG -3'
(R):5'- AAGAGGTCAGCTCTTTTATCTCATGG -3'
Posted On2016-06-21