Incidental Mutation 'R5141:Lrp4'
ID396440
Institutional Source Beutler Lab
Gene Symbol Lrp4
Ensembl Gene ENSMUSG00000027253
Gene Namelow density lipoprotein receptor-related protein 4
Synonymsmdig, Megf7
MMRRC Submission 042727-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.612) question?
Stock #R5141 (G1)
Quality Score172
Status Validated
Chromosome2
Chromosomal Location91457511-91513779 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 91478678 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028689]
Predicted Effect probably benign
Transcript: ENSMUST00000028689
SMART Domains Protein: ENSMUSP00000028689
Gene: ENSMUSG00000027253

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LDLa 26 68 5.77e-10 SMART
LDLa 70 107 4.05e-14 SMART
LDLa 109 145 1.9e-10 SMART
LDLa 147 184 1.51e-13 SMART
LDLa 190 227 6.83e-12 SMART
LDLa 230 267 2.45e-13 SMART
LDLa 269 306 6.32e-16 SMART
LDLa 311 351 3.24e-13 SMART
EGF 357 394 1.4e0 SMART
EGF_CA 395 434 1.05e-8 SMART
LY 460 502 7.01e-10 SMART
LY 503 545 4.41e-16 SMART
LY 546 589 1.04e-12 SMART
LY 590 632 5.07e-16 SMART
LY 633 674 3.12e-7 SMART
EGF 701 737 9.27e-1 SMART
LY 765 807 7.29e-8 SMART
LY 808 850 1.92e-16 SMART
LY 851 894 3.05e-10 SMART
LY 895 937 6.69e-16 SMART
LY 938 979 8.71e-6 SMART
EGF 1005 1044 1.64e-1 SMART
LY 1073 1115 2.58e-8 SMART
LY 1116 1158 1.57e-12 SMART
LY 1159 1202 7.4e-9 SMART
LY 1203 1245 9.39e-11 SMART
LY 1246 1285 6.11e-1 SMART
EGF 1312 1349 1.53e-1 SMART
LY 1377 1419 4.42e-7 SMART
LY 1420 1462 1.04e-12 SMART
LY 1463 1506 2.11e-13 SMART
LY 1507 1549 4.66e-15 SMART
LY 1550 1590 2.02e-1 SMART
EGF_like 1616 1649 5.79e1 SMART
low complexity region 1674 1690 N/A INTRINSIC
transmembrane domain 1724 1746 N/A INTRINSIC
low complexity region 1857 1870 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151907
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (76/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low-density lipoprotein receptor-related protein family. The encoded protein may be a regulator of Wnt signaling. Mutations in this gene are associated with Cenani-Lenz syndrome. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations of this gene cause polysyndactyly. Additional phenotypes may include growth retardation, abnormal incisor development, kidney agenesis, and neonatal lethality associated with respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A G 14: 68,573,128 V193A probably benign Het
Adamts18 T A 8: 113,775,270 T320S probably damaging Het
Adamtsl1 G T 4: 86,156,850 M151I possibly damaging Het
Adgrv1 A T 13: 81,270,918 V5986E probably damaging Het
Aifm3 A G 16: 17,499,722 E69G probably damaging Het
Akap13 C A 7: 75,609,614 T662K probably benign Het
Alms1 A G 6: 85,621,432 D1080G probably benign Het
Als2 T C 1: 59,170,452 E1457G possibly damaging Het
Apobec4 A G 1: 152,756,213 probably benign Het
Apoo-ps C T 13: 107,414,395 noncoding transcript Het
Aspscr1 G A 11: 120,689,177 V181I probably benign Het
Atrn T C 2: 130,999,130 probably benign Het
C3 T A 17: 57,219,570 I804F probably damaging Het
Cbfa2t3 C T 8: 122,635,021 G421R probably benign Het
Chmp4c A G 3: 10,367,153 E41G probably damaging Het
Clk4 T A 11: 51,275,771 F96L possibly damaging Het
Ctsg G A 14: 56,101,727 R25* probably null Het
Cul1 A G 6: 47,520,839 D618G probably benign Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dip2a G A 10: 76,270,453 T1326I probably damaging Het
Etnk2 A G 1: 133,368,862 I210V probably benign Het
Gm5773 T A 3: 93,773,727 D235E probably benign Het
Gm7353 T C 7: 3,111,001 noncoding transcript Het
Gpi1 G A 7: 34,227,096 probably benign Het
Ing4 T C 6: 125,039,874 M5T probably benign Het
Inpp4a A G 1: 37,380,087 I583V probably benign Het
Isyna1 T C 8: 70,594,893 V64A probably damaging Het
Katnal2 T A 18: 76,997,641 D310V probably damaging Het
Kbtbd8 A G 6: 95,121,839 T126A probably damaging Het
Kif13a T C 13: 46,752,721 D582G probably benign Het
Lmf2 G A 15: 89,351,607 probably null Het
Lrp2 T C 2: 69,552,349 probably null Het
Lyzl1 A C 18: 4,169,209 D71A possibly damaging Het
Mak C T 13: 41,032,563 C543Y possibly damaging Het
Mapk8ip1 T C 2: 92,386,765 D404G probably damaging Het
Mdga1 C T 17: 29,852,493 E385K probably benign Het
Mst1r T A 9: 107,912,241 I573N probably damaging Het
Muc5ac T A 7: 141,814,742 N2365K possibly damaging Het
Ncan T C 8: 70,112,837 E179G probably damaging Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1228 A C 2: 89,249,129 Y176* probably null Het
Olfr44 A G 9: 39,484,531 F238L probably damaging Het
Olfr975 T G 9: 39,949,874 K299T probably benign Het
Pcolce G T 5: 137,605,750 Q352K probably benign Het
Peg3 G T 7: 6,709,382 T947N probably benign Het
Pld3 C T 7: 27,533,795 D344N probably damaging Het
Plec A C 15: 76,190,533 D411E probably damaging Het
Pmp2 C T 3: 10,182,414 D72N probably benign Het
Ptpn9 T C 9: 57,036,676 V278A possibly damaging Het
Rbm33 A G 5: 28,352,689 H300R probably damaging Het
Rpgrip1l T C 8: 91,260,918 Q837R probably benign Het
Rwdd4a T C 8: 47,550,674 probably benign Het
Sema6a T C 18: 47,248,388 T1048A probably damaging Het
Senp1 G A 15: 98,076,607 A108V probably benign Het
Serpine2 G T 1: 79,802,863 Q290K possibly damaging Het
Sesn1 A G 10: 41,811,101 N27S probably benign Het
Shroom1 T A 11: 53,463,982 L243* probably null Het
Slc17a5 A G 9: 78,540,988 Y395H probably damaging Het
Slc5a8 T C 10: 88,919,560 probably null Het
Sptbn5 G A 2: 120,061,731 S1083F probably benign Het
Stx4a T A 7: 127,846,615 V231E probably damaging Het
Swt1 A T 1: 151,411,394 S116T probably benign Het
Syt9 C T 7: 107,504,219 T408I probably damaging Het
Tgm7 T C 2: 121,100,999 T228A probably benign Het
Tmem115 A G 9: 107,537,942 D310G probably benign Het
Trcg1 G A 9: 57,241,304 G53D probably damaging Het
Tsfm T C 10: 127,029,613 K100E probably damaging Het
Usp1 A G 4: 98,934,209 T587A probably damaging Het
Vcpip1 G T 1: 9,748,077 A27E unknown Het
Vmn2r49 T C 7: 9,986,373 N397S probably benign Het
Vmn2r8 A G 5: 108,808,706 S17P probably damaging Het
Vwa3b A G 1: 37,187,021 probably benign Het
Ythdc2 T A 18: 44,865,047 S1094T probably benign Het
Zbtb22 C G 17: 33,918,636 S585C possibly damaging Het
Zhx2 A G 15: 57,821,786 T184A probably benign Het
Other mutations in Lrp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Lrp4 APN 2 91495026 missense probably benign
IGL00509:Lrp4 APN 2 91486174 splice site probably benign
IGL01145:Lrp4 APN 2 91487051 missense probably damaging 1.00
IGL01287:Lrp4 APN 2 91473948 missense probably damaging 1.00
IGL01531:Lrp4 APN 2 91511553 missense probably damaging 1.00
IGL01534:Lrp4 APN 2 91473641 missense probably damaging 1.00
IGL01544:Lrp4 APN 2 91477551 missense probably damaging 1.00
IGL01761:Lrp4 APN 2 91481981 critical splice donor site probably null
IGL01885:Lrp4 APN 2 91501107 missense probably benign 0.05
IGL01909:Lrp4 APN 2 91494184 missense possibly damaging 0.50
IGL02111:Lrp4 APN 2 91506059 missense probably damaging 1.00
IGL02385:Lrp4 APN 2 91474720 missense possibly damaging 0.89
IGL02403:Lrp4 APN 2 91508582 missense probably benign 0.05
IGL02431:Lrp4 APN 2 91476637 missense possibly damaging 0.95
IGL02452:Lrp4 APN 2 91474002 missense probably damaging 1.00
IGL02798:Lrp4 APN 2 91476710 missense probably benign 0.02
IGL02828:Lrp4 APN 2 91475294 missense probably benign
IGL02832:Lrp4 APN 2 91511580 missense probably damaging 1.00
IGL02893:Lrp4 APN 2 91474816 missense possibly damaging 0.76
F5770:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
R0037:Lrp4 UTSW 2 91471203 missense probably benign 0.22
R0037:Lrp4 UTSW 2 91471203 missense probably benign 0.22
R0137:Lrp4 UTSW 2 91494982 missense probably damaging 1.00
R0265:Lrp4 UTSW 2 91490670 missense probably damaging 1.00
R0368:Lrp4 UTSW 2 91477734 missense probably damaging 0.99
R0531:Lrp4 UTSW 2 91475178 splice site probably benign
R0827:Lrp4 UTSW 2 91495041 missense probably damaging 1.00
R1029:Lrp4 UTSW 2 91487027 splice site probably benign
R1183:Lrp4 UTSW 2 91477519 critical splice acceptor site probably null
R1587:Lrp4 UTSW 2 91476305 missense probably benign 0.26
R1693:Lrp4 UTSW 2 91492353 missense probably damaging 1.00
R1747:Lrp4 UTSW 2 91492621 missense probably damaging 0.98
R1863:Lrp4 UTSW 2 91498363 missense probably benign 0.15
R1908:Lrp4 UTSW 2 91498408 missense possibly damaging 0.93
R1909:Lrp4 UTSW 2 91498408 missense possibly damaging 0.93
R1932:Lrp4 UTSW 2 91497355 nonsense probably null
R1934:Lrp4 UTSW 2 91480432 missense probably damaging 1.00
R2358:Lrp4 UTSW 2 91501954 missense probably benign 0.01
R2433:Lrp4 UTSW 2 91506015 missense probably benign 0.00
R2698:Lrp4 UTSW 2 91475212 missense probably damaging 0.99
R2919:Lrp4 UTSW 2 91490730 missense probably benign 0.01
R3105:Lrp4 UTSW 2 91501049 missense probably benign
R3709:Lrp4 UTSW 2 91490466 missense possibly damaging 0.60
R3711:Lrp4 UTSW 2 91501954 missense probably benign 0.01
R3735:Lrp4 UTSW 2 91498371 missense probably damaging 1.00
R3808:Lrp4 UTSW 2 91476702 missense probably damaging 0.99
R3894:Lrp4 UTSW 2 91473949 missense probably damaging 1.00
R3895:Lrp4 UTSW 2 91473949 missense probably damaging 1.00
R4397:Lrp4 UTSW 2 91511670 missense probably benign 0.20
R4741:Lrp4 UTSW 2 91511567 missense probably damaging 1.00
R4948:Lrp4 UTSW 2 91485886 missense probably benign
R5050:Lrp4 UTSW 2 91492422 missense probably benign 0.22
R5096:Lrp4 UTSW 2 91485792 missense possibly damaging 0.65
R5110:Lrp4 UTSW 2 91497072 missense possibly damaging 0.48
R5439:Lrp4 UTSW 2 91497073 missense probably benign 0.14
R5725:Lrp4 UTSW 2 91494895 missense probably damaging 1.00
R5795:Lrp4 UTSW 2 91474471 missense probably benign 0.01
R5820:Lrp4 UTSW 2 91492615 missense probably damaging 0.99
R5883:Lrp4 UTSW 2 91488433 missense probably benign 0.01
R5919:Lrp4 UTSW 2 91473207 missense probably damaging 1.00
R5925:Lrp4 UTSW 2 91511684 missense probably benign 0.01
R6080:Lrp4 UTSW 2 91502000 missense probably benign
R6189:Lrp4 UTSW 2 91475234 missense possibly damaging 0.63
R6192:Lrp4 UTSW 2 91508488 missense probably benign 0.00
R6319:Lrp4 UTSW 2 91480321 missense probably damaging 1.00
R6378:Lrp4 UTSW 2 91493829 missense probably benign 0.18
R6479:Lrp4 UTSW 2 91487084 missense probably damaging 0.96
R6500:Lrp4 UTSW 2 91492420 missense possibly damaging 0.90
R6643:Lrp4 UTSW 2 91501995 missense probably benign
R6657:Lrp4 UTSW 2 91492053 missense probably benign 0.00
R6696:Lrp4 UTSW 2 91497345 missense probably benign 0.03
R6714:Lrp4 UTSW 2 91476365 missense possibly damaging 0.90
R6734:Lrp4 UTSW 2 91485897 missense possibly damaging 0.79
R6770:Lrp4 UTSW 2 91497303 missense probably benign 0.33
R6774:Lrp4 UTSW 2 91511504 missense probably benign 0.01
R6957:Lrp4 UTSW 2 91487042 missense probably damaging 0.99
R6978:Lrp4 UTSW 2 91491998 missense probably damaging 1.00
R7065:Lrp4 UTSW 2 91511580 missense probably damaging 1.00
R7142:Lrp4 UTSW 2 91494994 missense probably damaging 0.99
R7219:Lrp4 UTSW 2 91492023 missense probably damaging 1.00
R7237:Lrp4 UTSW 2 91473183 missense probably benign 0.04
R7387:Lrp4 UTSW 2 91476614 missense probably benign
R7585:Lrp4 UTSW 2 91492588 missense probably damaging 1.00
V7580:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
V7581:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
V7582:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
V7583:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
X0021:Lrp4 UTSW 2 91501062 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GTTTCCAGGACGCAGAGCTA -3'
(R):5'- GGTTGAGTAAGCCAAGGATGTT -3'

Sequencing Primer
(F):5'- CTACCTAGGGTGAATGGCTGACAC -3'
(R):5'- TAAGCCAAGGATGTTCAGCC -3'
Posted On2016-06-21