Incidental Mutation 'R5141:Mapk8ip1'
ID396441
Institutional Source Beutler Lab
Gene Symbol Mapk8ip1
Ensembl Gene ENSMUSG00000027223
Gene Namemitogen-activated protein kinase 8 interacting protein 1
SynonymsMAPK8IP1, IB1, Jip1, mjip-2a, Prkm8ip, Skip, JIP-1
MMRRC Submission 042727-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.596) question?
Stock #R5141 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location92383676-92401263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92386765 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 404 (D404G)
Ref Sequence ENSEMBL: ENSMUSP00000050773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050312] [ENSMUST00000054316] [ENSMUST00000111279] [ENSMUST00000111280] [ENSMUST00000191292]
PDB Structure
Structural basis for the selective inhibition of JNK1 by the scaffolding protein JIP1 and SP600125 [X-RAY DIFFRACTION]
Structural basis for the selective inhibition of JNK1 by the scaffolding protein JIP1 and SP600125 [X-RAY DIFFRACTION]
Crystal Structure of JNK1-alpha1 isoform [X-RAY DIFFRACTION]
Crystal Structure of JNK1-alpha1 isoform complex with a biaryl tetrazol (A-82118) [X-RAY DIFFRACTION]
Structural and functional analysis of quercetagetin, a natural JNK1 inhibitor [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000050312
AA Change: D404G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050773
Gene: ENSMUSG00000027223
AA Change: D404G

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
low complexity region 38 51 N/A INTRINSIC
low complexity region 71 87 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
SH3 487 544 2.62e-11 SMART
PTB 558 700 1.2e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054316
SMART Domains Protein: ENSMUSP00000051464
Gene: ENSMUSG00000044916

DomainStartEndE-ValueType
Pfam:DUF4733 4 97 7.7e-50 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111279
AA Change: D395G

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106910
Gene: ENSMUSG00000027223
AA Change: D395G

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
low complexity region 62 78 N/A INTRINSIC
low complexity region 89 110 N/A INTRINSIC
low complexity region 233 245 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
SH3 478 535 2.62e-11 SMART
PTB 549 691 1.2e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111280
SMART Domains Protein: ENSMUSP00000106911
Gene: ENSMUSG00000044916

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149653
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189714
Predicted Effect probably benign
Transcript: ENSMUST00000191292
Meta Mutation Damage Score 0.2135 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (76/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of the pancreatic beta-cell function. It is highly similar to JIP-1, a mouse protein known to be a regulator of c-Jun amino-terminal kinase (Mapk8). This protein has been shown to prevent MAPK8 mediated activation of transcription factors, and to decrease IL-1 beta and MAP kinase kinase 1 (MEKK1) induced apoptosis in pancreatic beta cells. This protein also functions as a DNA-binding transactivator of the glucose transporter GLUT2. RE1-silencing transcription factor (REST) is reported to repress the expression of this gene in insulin-secreting beta cells. This gene is found to be mutated in a type 2 diabetes family, and thus is thought to be a susceptibility gene for type 2 diabetes. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous mutation of this gene results in a decreased susceptibility to ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A G 14: 68,573,128 V193A probably benign Het
Adamts18 T A 8: 113,775,270 T320S probably damaging Het
Adamtsl1 G T 4: 86,156,850 M151I possibly damaging Het
Adgrv1 A T 13: 81,270,918 V5986E probably damaging Het
Aifm3 A G 16: 17,499,722 E69G probably damaging Het
Akap13 C A 7: 75,609,614 T662K probably benign Het
Alms1 A G 6: 85,621,432 D1080G probably benign Het
Als2 T C 1: 59,170,452 E1457G possibly damaging Het
Apobec4 A G 1: 152,756,213 probably benign Het
Apoo-ps C T 13: 107,414,395 noncoding transcript Het
Aspscr1 G A 11: 120,689,177 V181I probably benign Het
Atrn T C 2: 130,999,130 probably benign Het
C3 T A 17: 57,219,570 I804F probably damaging Het
Cbfa2t3 C T 8: 122,635,021 G421R probably benign Het
Chmp4c A G 3: 10,367,153 E41G probably damaging Het
Clk4 T A 11: 51,275,771 F96L possibly damaging Het
Ctsg G A 14: 56,101,727 R25* probably null Het
Cul1 A G 6: 47,520,839 D618G probably benign Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dip2a G A 10: 76,270,453 T1326I probably damaging Het
Etnk2 A G 1: 133,368,862 I210V probably benign Het
Gm5773 T A 3: 93,773,727 D235E probably benign Het
Gm7353 T C 7: 3,111,001 noncoding transcript Het
Gpi1 G A 7: 34,227,096 probably benign Het
Ing4 T C 6: 125,039,874 M5T probably benign Het
Inpp4a A G 1: 37,380,087 I583V probably benign Het
Isyna1 T C 8: 70,594,893 V64A probably damaging Het
Katnal2 T A 18: 76,997,641 D310V probably damaging Het
Kbtbd8 A G 6: 95,121,839 T126A probably damaging Het
Kif13a T C 13: 46,752,721 D582G probably benign Het
Lmf2 G A 15: 89,351,607 probably null Het
Lrp2 T C 2: 69,552,349 probably null Het
Lrp4 T C 2: 91,478,678 probably benign Het
Lyzl1 A C 18: 4,169,209 D71A possibly damaging Het
Mak C T 13: 41,032,563 C543Y possibly damaging Het
Mdga1 C T 17: 29,852,493 E385K probably benign Het
Mst1r T A 9: 107,912,241 I573N probably damaging Het
Muc5ac T A 7: 141,814,742 N2365K possibly damaging Het
Ncan T C 8: 70,112,837 E179G probably damaging Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1228 A C 2: 89,249,129 Y176* probably null Het
Olfr44 A G 9: 39,484,531 F238L probably damaging Het
Olfr975 T G 9: 39,949,874 K299T probably benign Het
Pcolce G T 5: 137,605,750 Q352K probably benign Het
Peg3 G T 7: 6,709,382 T947N probably benign Het
Pld3 C T 7: 27,533,795 D344N probably damaging Het
Plec A C 15: 76,190,533 D411E probably damaging Het
Pmp2 C T 3: 10,182,414 D72N probably benign Het
Ptpn9 T C 9: 57,036,676 V278A possibly damaging Het
Rbm33 A G 5: 28,352,689 H300R probably damaging Het
Rpgrip1l T C 8: 91,260,918 Q837R probably benign Het
Rwdd4a T C 8: 47,550,674 probably benign Het
Sema6a T C 18: 47,248,388 T1048A probably damaging Het
Senp1 G A 15: 98,076,607 A108V probably benign Het
Serpine2 G T 1: 79,802,863 Q290K possibly damaging Het
Sesn1 A G 10: 41,811,101 N27S probably benign Het
Shroom1 T A 11: 53,463,982 L243* probably null Het
Slc17a5 A G 9: 78,540,988 Y395H probably damaging Het
Slc5a8 T C 10: 88,919,560 probably null Het
Sptbn5 G A 2: 120,061,731 S1083F probably benign Het
Stx4a T A 7: 127,846,615 V231E probably damaging Het
Swt1 A T 1: 151,411,394 S116T probably benign Het
Syt9 C T 7: 107,504,219 T408I probably damaging Het
Tgm7 T C 2: 121,100,999 T228A probably benign Het
Tmem115 A G 9: 107,537,942 D310G probably benign Het
Trcg1 G A 9: 57,241,304 G53D probably damaging Het
Tsfm T C 10: 127,029,613 K100E probably damaging Het
Usp1 A G 4: 98,934,209 T587A probably damaging Het
Vcpip1 G T 1: 9,748,077 A27E unknown Het
Vmn2r49 T C 7: 9,986,373 N397S probably benign Het
Vmn2r8 A G 5: 108,808,706 S17P probably damaging Het
Vwa3b A G 1: 37,187,021 probably benign Het
Ythdc2 T A 18: 44,865,047 S1094T probably benign Het
Zbtb22 C G 17: 33,918,636 S585C possibly damaging Het
Zhx2 A G 15: 57,821,786 T184A probably benign Het
Other mutations in Mapk8ip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Mapk8ip1 APN 2 92385188 missense probably benign 0.06
IGL01538:Mapk8ip1 APN 2 92388974 critical splice donor site probably null
IGL02089:Mapk8ip1 APN 2 92385875 missense probably damaging 1.00
IGL02177:Mapk8ip1 APN 2 92386747 missense probably damaging 1.00
IGL03032:Mapk8ip1 APN 2 92386613 missense probably damaging 1.00
IGL03180:Mapk8ip1 APN 2 92386912 missense possibly damaging 0.91
R0243:Mapk8ip1 UTSW 2 92385944 missense probably damaging 1.00
R0483:Mapk8ip1 UTSW 2 92385976 splice site probably null
R0515:Mapk8ip1 UTSW 2 92387356 missense possibly damaging 0.71
R2016:Mapk8ip1 UTSW 2 92391034 critical splice donor site probably null
R2017:Mapk8ip1 UTSW 2 92391034 critical splice donor site probably null
R5858:Mapk8ip1 UTSW 2 92384972 missense probably damaging 1.00
R6194:Mapk8ip1 UTSW 2 92389244 missense probably damaging 0.98
R6243:Mapk8ip1 UTSW 2 92389244 missense probably damaging 0.98
R6244:Mapk8ip1 UTSW 2 92389244 missense probably damaging 0.98
R6245:Mapk8ip1 UTSW 2 92389244 missense probably damaging 0.98
R6984:Mapk8ip1 UTSW 2 92386727 missense probably damaging 1.00
R7471:Mapk8ip1 UTSW 2 92389144 missense probably benign
R7588:Mapk8ip1 UTSW 2 92386639 missense possibly damaging 0.77
R7810:Mapk8ip1 UTSW 2 92389151 missense probably benign 0.05
R8021:Mapk8ip1 UTSW 2 92386415 missense not run
X0023:Mapk8ip1 UTSW 2 92386601 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CGGCCACTCATGAAGACATTC -3'
(R):5'- GCTTACTCTGTAACTGCGGG -3'

Sequencing Primer
(F):5'- AGTGGACATCAGGCTCAT -3'
(R):5'- CCCTCCATCAGTGAAGAGGATG -3'
Posted On2016-06-21