Mutagenetix > Incidental Mutations

Incidental Mutation 'R5141:Atrn'

396444

Institutional Source

Beutler Lab

Gene Symbol

Atrn

Ensembl Gene

ENSMUSG00000027312

Gene Name

attractin

Synonyms

Mgca

MMRRC Submission

042727-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5141 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

130906495-131030333 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to C at 130999130 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000028781 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028781]

Predicted Effect

probably benign
Transcript: ENSMUST00000028781

SMART Domains

Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312

Domain	Start	End	E-Value	Type
low complexity region	2	9	N/A	INTRINSIC
low complexity region	51	97	N/A	INTRINSIC
EGF	99	129	9.85e-5	SMART
CUB	131	247	7.85e-18	SMART
EGF	248	282	1.47e1	SMART
Pfam:Kelch_1	339	382	1.1e-7	PFAM
Pfam:Kelch_5	389	434	2.5e-7	PFAM
Pfam:Kelch_6	390	439	3.3e-8	PFAM
Pfam:Kelch_1	553	606	8.4e-8	PFAM
PSI	646	693	7.41e-7	SMART
PSI	702	747	8.64e-8	SMART
PSI	754	799	2.11e-2	SMART
CLECT	787	918	6.14e-20	SMART
PSI	931	982	1.11e-5	SMART
PSI	985	1060	1.2e-6	SMART
EGF_Lam	1062	1105	1.97e-4	SMART
EGF_like	1108	1154	3.9e0	SMART
transmembrane domain	1278	1300	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
low complexity region	1373	1385	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132557

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134964

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151364

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

96% (76/79)

MGI Phenotype

FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamdec1	A	G	14: 68,573,128	V193A	probably benign	Het
Adamts18	T	A	8: 113,775,270	T320S	probably damaging	Het
Adamtsl1	G	T	4: 86,156,850	M151I	possibly damaging	Het
Adgrv1	A	T	13: 81,270,918	V5986E	probably damaging	Het
Aifm3	A	G	16: 17,499,722	E69G	probably damaging	Het
Akap13	C	A	7: 75,609,614	T662K	probably benign	Het
Alms1	A	G	6: 85,621,432	D1080G	probably benign	Het
Als2	T	C	1: 59,170,452	E1457G	possibly damaging	Het
Apobec4	A	G	1: 152,756,213		probably benign	Het
Apoo-ps	C	T	13: 107,414,395		noncoding transcript	Het
Aspscr1	G	A	11: 120,689,177	V181I	probably benign	Het
C3	T	A	17: 57,219,570	I804F	probably damaging	Het
Cbfa2t3	C	T	8: 122,635,021	G421R	probably benign	Het
Chmp4c	A	G	3: 10,367,153	E41G	probably damaging	Het
Clk4	T	A	11: 51,275,771	F96L	possibly damaging	Het
Ctsg	G	A	14: 56,101,727	R25*	probably null	Het
Cul1	A	G	6: 47,520,839	D618G	probably benign	Het
Cylc2	T	C	4: 51,228,587		probably benign	Het
Dip2a	G	A	10: 76,270,453	T1326I	probably damaging	Het
Etnk2	A	G	1: 133,368,862	I210V	probably benign	Het
Gm5773	T	A	3: 93,773,727	D235E	probably benign	Het
Gm7353	T	C	7: 3,111,001		noncoding transcript	Het
Gpi1	G	A	7: 34,227,096		probably benign	Het
Ing4	T	C	6: 125,039,874	M5T	probably benign	Het
Inpp4a	A	G	1: 37,380,087	I583V	probably benign	Het
Isyna1	T	C	8: 70,594,893	V64A	probably damaging	Het
Katnal2	T	A	18: 76,997,641	D310V	probably damaging	Het
Kbtbd8	A	G	6: 95,121,839	T126A	probably damaging	Het
Kif13a	T	C	13: 46,752,721	D582G	probably benign	Het
Lmf2	G	A	15: 89,351,607		probably null	Het
Lrp2	T	C	2: 69,552,349		probably null	Het
Lrp4	T	C	2: 91,478,678		probably benign	Het
Lyzl1	A	C	18: 4,169,209	D71A	possibly damaging	Het
Mak	C	T	13: 41,032,563	C543Y	possibly damaging	Het
Mapk8ip1	T	C	2: 92,386,765	D404G	probably damaging	Het
Mdga1	C	T	17: 29,852,493	E385K	probably benign	Het
Mst1r	T	A	9: 107,912,241	I573N	probably damaging	Het
Muc5ac	T	A	7: 141,814,742	N2365K	possibly damaging	Het
Ncan	T	C	8: 70,112,837	E179G	probably damaging	Het
Nlgn2	C	T	11: 69,825,390	R775H	probably damaging	Het
Olfr1228	A	C	2: 89,249,129	Y176*	probably null	Het
Olfr44	A	G	9: 39,484,531	F238L	probably damaging	Het
Olfr975	T	G	9: 39,949,874	K299T	probably benign	Het
Pcolce	G	T	5: 137,605,750	Q352K	probably benign	Het
Peg3	G	T	7: 6,709,382	T947N	probably benign	Het
Pld3	C	T	7: 27,533,795	D344N	probably damaging	Het
Plec	A	C	15: 76,190,533	D411E	probably damaging	Het
Pmp2	C	T	3: 10,182,414	D72N	probably benign	Het
Ptpn9	T	C	9: 57,036,676	V278A	possibly damaging	Het
Rbm33	A	G	5: 28,352,689	H300R	probably damaging	Het
Rpgrip1l	T	C	8: 91,260,918	Q837R	probably benign	Het
Rwdd4a	T	C	8: 47,550,674		probably benign	Het
Sema6a	T	C	18: 47,248,388	T1048A	probably damaging	Het
Senp1	G	A	15: 98,076,607	A108V	probably benign	Het
Serpine2	G	T	1: 79,802,863	Q290K	possibly damaging	Het
Sesn1	A	G	10: 41,811,101	N27S	probably benign	Het
Shroom1	T	A	11: 53,463,982	L243*	probably null	Het
Slc17a5	A	G	9: 78,540,988	Y395H	probably damaging	Het
Slc5a8	T	C	10: 88,919,560		probably null	Het
Sptbn5	G	A	2: 120,061,731	S1083F	probably benign	Het
Stx4a	T	A	7: 127,846,615	V231E	probably damaging	Het
Swt1	A	T	1: 151,411,394	S116T	probably benign	Het
Syt9	C	T	7: 107,504,219	T408I	probably damaging	Het
Tgm7	T	C	2: 121,100,999	T228A	probably benign	Het
Tmem115	A	G	9: 107,537,942	D310G	probably benign	Het
Trcg1	G	A	9: 57,241,304	G53D	probably damaging	Het
Tsfm	T	C	10: 127,029,613	K100E	probably damaging	Het
Usp1	A	G	4: 98,934,209	T587A	probably damaging	Het
Vcpip1	G	T	1: 9,748,077	A27E	unknown	Het
Vmn2r49	T	C	7: 9,986,373	N397S	probably benign	Het
Vmn2r8	A	G	5: 108,808,706	S17P	probably damaging	Het
Vwa3b	A	G	1: 37,187,021		probably benign	Het
Ythdc2	T	A	18: 44,865,047	S1094T	probably benign	Het
Zbtb22	C	G	17: 33,918,636	S585C	possibly damaging	Het
Zhx2	A	G	15: 57,821,786	T184A	probably benign	Het

Other mutations in Atrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Atrn	APN	2	130958079	missense	probably damaging	1.00
IGL00571:Atrn	APN	2	130995048	missense	probably damaging	1.00
IGL01092:Atrn	APN	2	130947636	nonsense	probably null
IGL01572:Atrn	APN	2	131002795	missense	probably damaging	1.00
IGL01924:Atrn	APN	2	130935565	missense	probably damaging	1.00
IGL02116:Atrn	APN	2	130958089	missense	probably damaging	1.00
IGL02372:Atrn	APN	2	131002754	splice site	probably benign
IGL02390:Atrn	APN	2	131020977	missense	possibly damaging	0.82
IGL02548:Atrn	APN	2	130972282	missense	probably damaging	1.00
IGL02749:Atrn	APN	2	130970144	nonsense	probably null
IGL02749:Atrn	APN	2	130947734	splice site	probably benign
BB010:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
BB020:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R0026:Atrn	UTSW	2	130957920	missense	probably damaging	1.00
R0403:Atrn	UTSW	2	130906859	missense	probably damaging	1.00
R0479:Atrn	UTSW	2	130999165	nonsense	probably null
R0544:Atrn	UTSW	2	130986826	missense	probably damaging	1.00
R0570:Atrn	UTSW	2	130980134	missense	probably benign	0.01
R0606:Atrn	UTSW	2	130906856	missense	possibly damaging	0.90
R0617:Atrn	UTSW	2	130995085	critical splice donor site	probably null
R0658:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R1108:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1112:Atrn	UTSW	2	130999161	missense	probably benign	0.04
R1219:Atrn	UTSW	2	131021007	missense	possibly damaging	0.90
R1422:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1524:Atrn	UTSW	2	130957080	missense	probably benign	0.15
R1653:Atrn	UTSW	2	130935624	missense	probably benign
R1795:Atrn	UTSW	2	130972288	missense	probably benign
R1807:Atrn	UTSW	2	130982772	missense	possibly damaging	0.94
R1920:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1921:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1935:Atrn	UTSW	2	130958035	missense	probably damaging	1.00
R1982:Atrn	UTSW	2	130970222	missense	probably benign
R2000:Atrn	UTSW	2	130935588	missense	probably damaging	1.00
R2143:Atrn	UTSW	2	130957996	missense	probably benign	0.03
R2336:Atrn	UTSW	2	130957954	missense	probably damaging	1.00
R2679:Atrn	UTSW	2	130961675	critical splice donor site	probably null
R3426:Atrn	UTSW	2	131020956	missense	probably benign	0.06
R3909:Atrn	UTSW	2	130994207	missense	probably damaging	1.00
R4077:Atrn	UTSW	2	130964930	critical splice donor site	probably null
R4162:Atrn	UTSW	2	130994228	splice site	probably benign
R4195:Atrn	UTSW	2	130933412	missense	probably damaging	1.00
R4364:Atrn	UTSW	2	130970208	missense	probably benign	0.39
R4465:Atrn	UTSW	2	130960468	missense	probably benign	0.08
R4510:Atrn	UTSW	2	130935577	nonsense	probably null
R4511:Atrn	UTSW	2	130935577	nonsense	probably null
R4527:Atrn	UTSW	2	130973504	missense	probably benign	0.10
R4586:Atrn	UTSW	2	130982042	missense	probably damaging	1.00
R4592:Atrn	UTSW	2	130999130	intron	probably benign
R4658:Atrn	UTSW	2	130933429	missense	probably damaging	1.00
R4735:Atrn	UTSW	2	131020990	missense	probably benign	0.06
R4960:Atrn	UTSW	2	130995047	nonsense	probably null
R4999:Atrn	UTSW	2	130975954	missense	probably damaging	1.00
R5066:Atrn	UTSW	2	130994193	missense	possibly damaging	0.60
R5080:Atrn	UTSW	2	130970124	missense	possibly damaging	0.95
R5256:Atrn	UTSW	2	130946019	missense	probably benign	0.39
R5494:Atrn	UTSW	2	131023075	missense	probably damaging	1.00
R5678:Atrn	UTSW	2	130970016	missense	probably damaging	0.96
R5752:Atrn	UTSW	2	130906544	unclassified	probably benign
R5931:Atrn	UTSW	2	130933436	missense	possibly damaging	0.56
R6023:Atrn	UTSW	2	131020980	missense	probably benign	0.25
R6176:Atrn	UTSW	2	130946091	missense	probably benign	0.31
R6377:Atrn	UTSW	2	130979969	missense	probably damaging	1.00
R6433:Atrn	UTSW	2	131023027	missense	probably damaging	1.00
R7226:Atrn	UTSW	2	130986744	missense	probably damaging	0.99
R7402:Atrn	UTSW	2	130947600	missense	probably damaging	1.00
R7541:Atrn	UTSW	2	130961571	missense	possibly damaging	0.46
R7587:Atrn	UTSW	2	130980114	missense	probably damaging	1.00
R7872:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R7910:Atrn	UTSW	2	130964887	missense	probably benign	0.04
R7913:Atrn	UTSW	2	130970211	missense	probably damaging	1.00
R7933:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R8044:Atrn	UTSW	2	130935529	missense	probably damaging	1.00
R8079:Atrn	UTSW	2	131013641	missense	probably null	1.00
R8093:Atrn	UTSW	2	130975988	missense	probably benign	0.00
R8203:Atrn	UTSW	2	130960549	missense	probably benign	0.00
R8234:Atrn	UTSW	2	131023000	critical splice acceptor site	probably null
RF009:Atrn	UTSW	2	130906922	missense	probably benign	0.12
X0024:Atrn	UTSW	2	130958139	missense	probably damaging	1.00
Z1088:Atrn	UTSW	2	130973399	missense	probably benign
Z1176:Atrn	UTSW	2	130946193	missense	probably benign	0.27
Z1177:Atrn	UTSW	2	130946042	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GAACATGTAAGTTGGCCATTAGTG -3'
(R):5'- TACTTTTGTCCAGGATGACCAAG -3'

Sequencing Primer
(F):5'- GGACCACACATCTGTATTTCTTATTC -3'
(R):5'- CAGGAGTAGCCACAAAGT -3'

Posted On

2016-06-21