Incidental Mutation 'R5141:Atrn'
ID 396444
Institutional Source Beutler Lab
Gene Symbol Atrn
Ensembl Gene ENSMUSG00000027312
Gene Name attractin
Synonyms Mgca
MMRRC Submission 042727-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5141 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 130906495-131030333 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) T to C at 130999130 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028781]
AlphaFold Q9WU60
Predicted Effect probably benign
Transcript: ENSMUST00000028781
SMART Domains Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
EGF 99 129 9.85e-5 SMART
CUB 131 247 7.85e-18 SMART
EGF 248 282 1.47e1 SMART
Pfam:Kelch_1 339 382 1.1e-7 PFAM
Pfam:Kelch_5 389 434 2.5e-7 PFAM
Pfam:Kelch_6 390 439 3.3e-8 PFAM
Pfam:Kelch_1 553 606 8.4e-8 PFAM
PSI 646 693 7.41e-7 SMART
PSI 702 747 8.64e-8 SMART
PSI 754 799 2.11e-2 SMART
CLECT 787 918 6.14e-20 SMART
PSI 931 982 1.11e-5 SMART
PSI 985 1060 1.2e-6 SMART
EGF_Lam 1062 1105 1.97e-4 SMART
EGF_like 1108 1154 3.9e0 SMART
transmembrane domain 1278 1300 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151364
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (76/79)
MGI Phenotype FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A G 14: 68,573,128 V193A probably benign Het
Adamts18 T A 8: 113,775,270 T320S probably damaging Het
Adamtsl1 G T 4: 86,156,850 M151I possibly damaging Het
Adgrv1 A T 13: 81,270,918 V5986E probably damaging Het
Aifm3 A G 16: 17,499,722 E69G probably damaging Het
Akap13 C A 7: 75,609,614 T662K probably benign Het
Alms1 A G 6: 85,621,432 D1080G probably benign Het
Als2 T C 1: 59,170,452 E1457G possibly damaging Het
Apobec4 A G 1: 152,756,213 probably benign Het
Apoo-ps C T 13: 107,414,395 noncoding transcript Het
Aspscr1 G A 11: 120,689,177 V181I probably benign Het
C3 T A 17: 57,219,570 I804F probably damaging Het
Cbfa2t3 C T 8: 122,635,021 G421R probably benign Het
Chmp4c A G 3: 10,367,153 E41G probably damaging Het
Clk4 T A 11: 51,275,771 F96L possibly damaging Het
Ctsg G A 14: 56,101,727 R25* probably null Het
Cul1 A G 6: 47,520,839 D618G probably benign Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dip2a G A 10: 76,270,453 T1326I probably damaging Het
Etnk2 A G 1: 133,368,862 I210V probably benign Het
Gm5773 T A 3: 93,773,727 D235E probably benign Het
Gm7353 T C 7: 3,111,001 noncoding transcript Het
Gpi1 G A 7: 34,227,096 probably benign Het
Ing4 T C 6: 125,039,874 M5T probably benign Het
Inpp4a A G 1: 37,380,087 I583V probably benign Het
Isyna1 T C 8: 70,594,893 V64A probably damaging Het
Katnal2 T A 18: 76,997,641 D310V probably damaging Het
Kbtbd8 A G 6: 95,121,839 T126A probably damaging Het
Kif13a T C 13: 46,752,721 D582G probably benign Het
Lmf2 G A 15: 89,351,607 probably null Het
Lrp2 T C 2: 69,552,349 probably null Het
Lrp4 T C 2: 91,478,678 probably benign Het
Lyzl1 A C 18: 4,169,209 D71A possibly damaging Het
Mak C T 13: 41,032,563 C543Y possibly damaging Het
Mapk8ip1 T C 2: 92,386,765 D404G probably damaging Het
Mdga1 C T 17: 29,852,493 E385K probably benign Het
Mst1r T A 9: 107,912,241 I573N probably damaging Het
Muc5ac T A 7: 141,814,742 N2365K possibly damaging Het
Ncan T C 8: 70,112,837 E179G probably damaging Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1228 A C 2: 89,249,129 Y176* probably null Het
Olfr44 A G 9: 39,484,531 F238L probably damaging Het
Olfr975 T G 9: 39,949,874 K299T probably benign Het
Pcolce G T 5: 137,605,750 Q352K probably benign Het
Peg3 G T 7: 6,709,382 T947N probably benign Het
Pld3 C T 7: 27,533,795 D344N probably damaging Het
Plec A C 15: 76,190,533 D411E probably damaging Het
Pmp2 C T 3: 10,182,414 D72N probably benign Het
Ptpn9 T C 9: 57,036,676 V278A possibly damaging Het
Rbm33 A G 5: 28,352,689 H300R probably damaging Het
Rpgrip1l T C 8: 91,260,918 Q837R probably benign Het
Rwdd4a T C 8: 47,550,674 probably benign Het
Sema6a T C 18: 47,248,388 T1048A probably damaging Het
Senp1 G A 15: 98,076,607 A108V probably benign Het
Serpine2 G T 1: 79,802,863 Q290K possibly damaging Het
Sesn1 A G 10: 41,811,101 N27S probably benign Het
Shroom1 T A 11: 53,463,982 L243* probably null Het
Slc17a5 A G 9: 78,540,988 Y395H probably damaging Het
Slc5a8 T C 10: 88,919,560 probably null Het
Sptbn5 G A 2: 120,061,731 S1083F probably benign Het
Stx4a T A 7: 127,846,615 V231E probably damaging Het
Swt1 A T 1: 151,411,394 S116T probably benign Het
Syt9 C T 7: 107,504,219 T408I probably damaging Het
Tgm7 T C 2: 121,100,999 T228A probably benign Het
Tmem115 A G 9: 107,537,942 D310G probably benign Het
Trcg1 G A 9: 57,241,304 G53D probably damaging Het
Tsfm T C 10: 127,029,613 K100E probably damaging Het
Usp1 A G 4: 98,934,209 T587A probably damaging Het
Vcpip1 G T 1: 9,748,077 A27E unknown Het
Vmn2r49 T C 7: 9,986,373 N397S probably benign Het
Vmn2r8 A G 5: 108,808,706 S17P probably damaging Het
Vwa3b A G 1: 37,187,021 probably benign Het
Ythdc2 T A 18: 44,865,047 S1094T probably benign Het
Zbtb22 C G 17: 33,918,636 S585C possibly damaging Het
Zhx2 A G 15: 57,821,786 T184A probably benign Het
Other mutations in Atrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Atrn APN 2 130958079 missense probably damaging 1.00
IGL00571:Atrn APN 2 130995048 missense probably damaging 1.00
IGL01092:Atrn APN 2 130947636 nonsense probably null
IGL01572:Atrn APN 2 131002795 missense probably damaging 1.00
IGL01924:Atrn APN 2 130935565 missense probably damaging 1.00
IGL02116:Atrn APN 2 130958089 missense probably damaging 1.00
IGL02372:Atrn APN 2 131002754 splice site probably benign
IGL02390:Atrn APN 2 131020977 missense possibly damaging 0.82
IGL02548:Atrn APN 2 130972282 missense probably damaging 1.00
IGL02749:Atrn APN 2 130970144 nonsense probably null
IGL02749:Atrn APN 2 130947734 splice site probably benign
BB010:Atrn UTSW 2 130995066 missense probably damaging 1.00
BB020:Atrn UTSW 2 130995066 missense probably damaging 1.00
R0026:Atrn UTSW 2 130957920 missense probably damaging 1.00
R0403:Atrn UTSW 2 130906859 missense probably damaging 1.00
R0479:Atrn UTSW 2 130999165 nonsense probably null
R0544:Atrn UTSW 2 130986826 missense probably damaging 1.00
R0570:Atrn UTSW 2 130980134 missense probably benign 0.01
R0606:Atrn UTSW 2 130906856 missense possibly damaging 0.90
R0617:Atrn UTSW 2 130995085 critical splice donor site probably null
R0658:Atrn UTSW 2 130970227 critical splice donor site probably null
R1108:Atrn UTSW 2 130957914 missense probably damaging 1.00
R1112:Atrn UTSW 2 130999161 missense probably benign 0.04
R1219:Atrn UTSW 2 131021007 missense possibly damaging 0.90
R1422:Atrn UTSW 2 130957914 missense probably damaging 1.00
R1524:Atrn UTSW 2 130957080 missense probably benign 0.15
R1653:Atrn UTSW 2 130935624 missense probably benign
R1795:Atrn UTSW 2 130972288 missense probably benign
R1807:Atrn UTSW 2 130982772 missense possibly damaging 0.94
R1920:Atrn UTSW 2 130995051 missense probably damaging 1.00
R1921:Atrn UTSW 2 130995051 missense probably damaging 1.00
R1935:Atrn UTSW 2 130958035 missense probably damaging 1.00
R1982:Atrn UTSW 2 130970222 missense probably benign
R2000:Atrn UTSW 2 130935588 missense probably damaging 1.00
R2143:Atrn UTSW 2 130957996 missense probably benign 0.03
R2336:Atrn UTSW 2 130957954 missense probably damaging 1.00
R2679:Atrn UTSW 2 130961675 critical splice donor site probably null
R3426:Atrn UTSW 2 131020956 missense probably benign 0.06
R3909:Atrn UTSW 2 130994207 missense probably damaging 1.00
R4077:Atrn UTSW 2 130964930 critical splice donor site probably null
R4162:Atrn UTSW 2 130994228 splice site probably benign
R4195:Atrn UTSW 2 130933412 missense probably damaging 1.00
R4364:Atrn UTSW 2 130970208 missense probably benign 0.39
R4465:Atrn UTSW 2 130960468 missense probably benign 0.08
R4510:Atrn UTSW 2 130935577 nonsense probably null
R4511:Atrn UTSW 2 130935577 nonsense probably null
R4527:Atrn UTSW 2 130973504 missense probably benign 0.10
R4586:Atrn UTSW 2 130982042 missense probably damaging 1.00
R4592:Atrn UTSW 2 130999130 intron probably benign
R4658:Atrn UTSW 2 130933429 missense probably damaging 1.00
R4735:Atrn UTSW 2 131020990 missense probably benign 0.06
R4960:Atrn UTSW 2 130995047 nonsense probably null
R4999:Atrn UTSW 2 130975954 missense probably damaging 1.00
R5066:Atrn UTSW 2 130994193 missense possibly damaging 0.60
R5080:Atrn UTSW 2 130970124 missense possibly damaging 0.95
R5256:Atrn UTSW 2 130946019 missense probably benign 0.39
R5494:Atrn UTSW 2 131023075 missense probably damaging 1.00
R5678:Atrn UTSW 2 130970016 missense probably damaging 0.96
R5752:Atrn UTSW 2 130906544 unclassified probably benign
R5931:Atrn UTSW 2 130933436 missense possibly damaging 0.56
R6023:Atrn UTSW 2 131020980 missense probably benign 0.25
R6176:Atrn UTSW 2 130946091 missense probably benign 0.31
R6377:Atrn UTSW 2 130979969 missense probably damaging 1.00
R6433:Atrn UTSW 2 131023027 missense probably damaging 1.00
R7226:Atrn UTSW 2 130986744 missense probably damaging 0.99
R7402:Atrn UTSW 2 130947600 missense probably damaging 1.00
R7541:Atrn UTSW 2 130961571 missense possibly damaging 0.46
R7587:Atrn UTSW 2 130980114 missense probably damaging 1.00
R7872:Atrn UTSW 2 130970227 critical splice donor site probably null
R7910:Atrn UTSW 2 130964887 missense probably benign 0.04
R7913:Atrn UTSW 2 130970211 missense probably damaging 1.00
R7933:Atrn UTSW 2 130995066 missense probably damaging 1.00
R8044:Atrn UTSW 2 130935529 missense probably damaging 1.00
R8079:Atrn UTSW 2 131013641 missense probably null 1.00
R8093:Atrn UTSW 2 130975988 missense probably benign 0.00
R8203:Atrn UTSW 2 130960549 missense probably benign 0.00
R8234:Atrn UTSW 2 131023000 critical splice acceptor site probably null
R8462:Atrn UTSW 2 130935584 missense probably damaging 1.00
R8816:Atrn UTSW 2 130906878 missense probably damaging 1.00
R8816:Atrn UTSW 2 131004574 missense probably damaging 1.00
R8831:Atrn UTSW 2 130906601 missense probably benign 0.22
R8937:Atrn UTSW 2 130999237 missense probably benign 0.00
R9161:Atrn UTSW 2 130935550 missense probably damaging 1.00
R9722:Atrn UTSW 2 130961616 missense probably damaging 1.00
R9786:Atrn UTSW 2 130944889 missense probably damaging 1.00
RF009:Atrn UTSW 2 130906922 missense probably benign 0.12
X0024:Atrn UTSW 2 130958139 missense probably damaging 1.00
Z1088:Atrn UTSW 2 130973399 missense probably benign
Z1176:Atrn UTSW 2 130946193 missense probably benign 0.27
Z1177:Atrn UTSW 2 130946042 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAACATGTAAGTTGGCCATTAGTG -3'
(R):5'- TACTTTTGTCCAGGATGACCAAG -3'

Sequencing Primer
(F):5'- GGACCACACATCTGTATTTCTTATTC -3'
(R):5'- CAGGAGTAGCCACAAAGT -3'
Posted On 2016-06-21