Mutagenetix > Incidental Mutations

Incidental Mutation 'R5141:Adamtsl1'

396449

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl1

Ensembl Gene

ENSMUSG00000066113

Gene Name

ADAMTS-like 1

Synonyms

5930437A14Rik, 6720426B09Rik, punctin-1

MMRRC Submission

042727-MU

Accession Numbers

Genbank: NM_172542; MGI: 1924989; Ensembl: ENSMUST00000141889

Is this an essential gene?

Probably non essential (E-score: 0.188) question?

Stock #

R5141 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85514172-86428385 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 86156850 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 151 (M151I)

Ref Sequence

ENSEMBL: ENSMUSP00000113330 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048885] [ENSMUST00000107178] [ENSMUST00000120678] [ENSMUST00000141889]

Predicted Effect

probably benign
Transcript: ENSMUST00000048885
AA Change: M151I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000043073
Gene: ENSMUSG00000066113
AA Change: M151I

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
TSP1	36	82	8.95e-7	SMART
TSP1	301	360	4.35e-2	SMART
TSP1	379	438	2.05e-2	SMART
TSP1	439	493	3.99e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107178
AA Change: M151I

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000102796
Gene: ENSMUSG00000066113
AA Change: M151I

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
TSP1	36	82	8.95e-7	SMART
TSP1	301	360	4.35e-2	SMART
TSP1	362	421	2.05e-2	SMART
TSP1	422	476	3.99e-4	SMART
TSP1	508	567	6.39e-3	SMART
TSP1	593	650	7.86e-3	SMART
TSP1	652	712	3.78e-5	SMART
TSP1	715	772	2.66e-2	SMART
TSP1	774	833	1.62e-4	SMART
IGc2	873	937	4.19e-6	SMART
low complexity region	1123	1142	N/A	INTRINSIC
IGc2	1175	1240	1.31e-7	SMART
IGc2	1282	1351	7.81e-15	SMART
IGc2	1400	1467	2.39e-10	SMART
TSP1	1481	1537	2.12e-1	SMART
TSP1	1540	1599	1.74e-4	SMART
TSP1	1600	1658	8.2e0	SMART
TSP1	1660	1717	1.96e-1	SMART
Pfam:PLAC	1721	1751	1.4e-9	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120678
AA Change: M151I

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000113330
Gene: ENSMUSG00000066113
AA Change: M151I

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
TSP1	36	82	8.95e-7	SMART
Blast:TSP1	108	157	5e-9	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000141889
AA Change: M151I

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000119278
Gene: ENSMUSG00000066113
AA Change: M151I

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
TSP1	36	82	8.95e-7	SMART
TSP1	301	360	4.35e-2	SMART
TSP1	379	438	2.05e-2	SMART
TSP1	439	493	3.99e-4	SMART
TSP1	525	584	6.39e-3	SMART
TSP1	610	667	7.86e-3	SMART
TSP1	707	764	2.66e-2	SMART
TSP1	766	825	1.62e-4	SMART
IGc2	865	929	4.19e-6	SMART
low complexity region	1115	1134	N/A	INTRINSIC
IGc2	1167	1232	1.31e-7	SMART
IGc2	1274	1343	7.81e-15	SMART
IGc2	1392	1459	2.39e-10	SMART
TSP1	1473	1529	2.12e-1	SMART
TSP1	1532	1591	1.74e-4	SMART
TSP1	1592	1650	8.2e0	SMART
TSP1	1652	1709	1.96e-1	SMART
Pfam:PLAC	1712	1744	5.6e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150043

Meta Mutation Damage Score

0.0864

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

96% (76/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein and member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family. This protein lacks the metalloproteinase and disintegrin-like domains, which are typical of the ADAMTS family, but contains other ADAMTS domains, including the thrombospondin type 1 motif. This protein may have important functions in the extracellular matrix. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamdec1	A	G	14: 68,573,128	V193A	probably benign	Het
Adamts18	T	A	8: 113,775,270	T320S	probably damaging	Het
Adgrv1	A	T	13: 81,270,918	V5986E	probably damaging	Het
Aifm3	A	G	16: 17,499,722	E69G	probably damaging	Het
Akap13	C	A	7: 75,609,614	T662K	probably benign	Het
Alms1	A	G	6: 85,621,432	D1080G	probably benign	Het
Als2	T	C	1: 59,170,452	E1457G	possibly damaging	Het
Apobec4	A	G	1: 152,756,213		probably benign	Het
Apoo-ps	C	T	13: 107,414,395		noncoding transcript	Het
Aspscr1	G	A	11: 120,689,177	V181I	probably benign	Het
Atrn	T	C	2: 130,999,130		probably benign	Het
C3	T	A	17: 57,219,570	I804F	probably damaging	Het
Cbfa2t3	C	T	8: 122,635,021	G421R	probably benign	Het
Chmp4c	A	G	3: 10,367,153	E41G	probably damaging	Het
Clk4	T	A	11: 51,275,771	F96L	possibly damaging	Het
Ctsg	G	A	14: 56,101,727	R25*	probably null	Het
Cul1	A	G	6: 47,520,839	D618G	probably benign	Het
Cylc2	T	C	4: 51,228,587		probably benign	Het
Dip2a	G	A	10: 76,270,453	T1326I	probably damaging	Het
Etnk2	A	G	1: 133,368,862	I210V	probably benign	Het
Gm5773	T	A	3: 93,773,727	D235E	probably benign	Het
Gm7353	T	C	7: 3,111,001		noncoding transcript	Het
Gpi1	G	A	7: 34,227,096		probably benign	Het
Ing4	T	C	6: 125,039,874	M5T	probably benign	Het
Inpp4a	A	G	1: 37,380,087	I583V	probably benign	Het
Isyna1	T	C	8: 70,594,893	V64A	probably damaging	Het
Katnal2	T	A	18: 76,997,641	D310V	probably damaging	Het
Kbtbd8	A	G	6: 95,121,839	T126A	probably damaging	Het
Kif13a	T	C	13: 46,752,721	D582G	probably benign	Het
Lmf2	G	A	15: 89,351,607		probably null	Het
Lrp2	T	C	2: 69,552,349		probably null	Het
Lrp4	T	C	2: 91,478,678		probably benign	Het
Lyzl1	A	C	18: 4,169,209	D71A	possibly damaging	Het
Mak	C	T	13: 41,032,563	C543Y	possibly damaging	Het
Mapk8ip1	T	C	2: 92,386,765	D404G	probably damaging	Het
Mdga1	C	T	17: 29,852,493	E385K	probably benign	Het
Mst1r	T	A	9: 107,912,241	I573N	probably damaging	Het
Muc5ac	T	A	7: 141,814,742	N2365K	possibly damaging	Het
Ncan	T	C	8: 70,112,837	E179G	probably damaging	Het
Nlgn2	C	T	11: 69,825,390	R775H	probably damaging	Het
Olfr1228	A	C	2: 89,249,129	Y176*	probably null	Het
Olfr44	A	G	9: 39,484,531	F238L	probably damaging	Het
Olfr975	T	G	9: 39,949,874	K299T	probably benign	Het
Pcolce	G	T	5: 137,605,750	Q352K	probably benign	Het
Peg3	G	T	7: 6,709,382	T947N	probably benign	Het
Pld3	C	T	7: 27,533,795	D344N	probably damaging	Het
Plec	A	C	15: 76,190,533	D411E	probably damaging	Het
Pmp2	C	T	3: 10,182,414	D72N	probably benign	Het
Ptpn9	T	C	9: 57,036,676	V278A	possibly damaging	Het
Rbm33	A	G	5: 28,352,689	H300R	probably damaging	Het
Rpgrip1l	T	C	8: 91,260,918	Q837R	probably benign	Het
Rwdd4a	T	C	8: 47,550,674		probably benign	Het
Sema6a	T	C	18: 47,248,388	T1048A	probably damaging	Het
Senp1	G	A	15: 98,076,607	A108V	probably benign	Het
Serpine2	G	T	1: 79,802,863	Q290K	possibly damaging	Het
Sesn1	A	G	10: 41,811,101	N27S	probably benign	Het
Shroom1	T	A	11: 53,463,982	L243*	probably null	Het
Slc17a5	A	G	9: 78,540,988	Y395H	probably damaging	Het
Slc5a8	T	C	10: 88,919,560		probably null	Het
Sptbn5	G	A	2: 120,061,731	S1083F	probably benign	Het
Stx4a	T	A	7: 127,846,615	V231E	probably damaging	Het
Swt1	A	T	1: 151,411,394	S116T	probably benign	Het
Syt9	C	T	7: 107,504,219	T408I	probably damaging	Het
Tgm7	T	C	2: 121,100,999	T228A	probably benign	Het
Tmem115	A	G	9: 107,537,942	D310G	probably benign	Het
Trcg1	G	A	9: 57,241,304	G53D	probably damaging	Het
Tsfm	T	C	10: 127,029,613	K100E	probably damaging	Het
Usp1	A	G	4: 98,934,209	T587A	probably damaging	Het
Vcpip1	G	T	1: 9,748,077	A27E	unknown	Het
Vmn2r49	T	C	7: 9,986,373	N397S	probably benign	Het
Vmn2r8	A	G	5: 108,808,706	S17P	probably damaging	Het
Vwa3b	A	G	1: 37,187,021		probably benign	Het
Ythdc2	T	A	18: 44,865,047	S1094T	probably benign	Het
Zbtb22	C	G	17: 33,918,636	S585C	possibly damaging	Het
Zhx2	A	G	15: 57,821,786	T184A	probably benign	Het

Other mutations in Adamtsl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Adamtsl1	APN	4	86385640	missense	probably benign	0.01
IGL00741:Adamtsl1	APN	4	86276948	missense	probably damaging	1.00
IGL00770:Adamtsl1	APN	4	86388539	missense	possibly damaging	0.65
IGL00774:Adamtsl1	APN	4	86388539	missense	possibly damaging	0.65
IGL00826:Adamtsl1	APN	4	86156804	missense	probably damaging	1.00
IGL00938:Adamtsl1	APN	4	86342278	missense	possibly damaging	0.93
IGL01012:Adamtsl1	APN	4	86342189	missense	possibly damaging	0.93
IGL01728:Adamtsl1	APN	4	86110837	missense	probably damaging	1.00
IGL01801:Adamtsl1	APN	4	86199322	missense	probably benign	0.23
IGL01922:Adamtsl1	APN	4	86249902	missense	probably damaging	1.00
IGL02006:Adamtsl1	APN	4	86199345	missense	probably damaging	1.00
IGL02192:Adamtsl1	APN	4	86228016	missense	probably damaging	1.00
IGL02351:Adamtsl1	APN	4	86156873	critical splice donor site	probably null
IGL02358:Adamtsl1	APN	4	86156873	critical splice donor site	probably null
IGL02373:Adamtsl1	APN	4	86249805	missense	probably damaging	1.00
IGL02660:Adamtsl1	APN	4	86232610	missense	probably damaging	1.00
IGL02964:Adamtsl1	APN	4	86424357	missense	probably damaging	1.00
IGL03233:Adamtsl1	APN	4	86342120	missense	probably damaging	1.00
IGL03297:Adamtsl1	APN	4	86423426	missense	probably damaging	0.98
IGL03326:Adamtsl1	APN	4	86252748	splice site	probably benign
PIT4378001:Adamtsl1	UTSW	4	86199364	missense	possibly damaging	0.93
PIT4418001:Adamtsl1	UTSW	4	86243724	missense	probably damaging	1.00
R0131:Adamtsl1	UTSW	4	86342723	missense	possibly damaging	0.94
R0131:Adamtsl1	UTSW	4	86342723	missense	possibly damaging	0.94
R0132:Adamtsl1	UTSW	4	86342723	missense	possibly damaging	0.94
R0453:Adamtsl1	UTSW	4	86232615	missense	probably damaging	1.00
R0480:Adamtsl1	UTSW	4	86252818	missense	probably benign	0.08
R0496:Adamtsl1	UTSW	4	86341198	missense	probably damaging	1.00
R0538:Adamtsl1	UTSW	4	86343121	missense	probably benign	0.27
R0547:Adamtsl1	UTSW	4	86356355	missense	probably benign	0.37
R0567:Adamtsl1	UTSW	4	86228016	missense	probably damaging	1.00
R0568:Adamtsl1	UTSW	4	86418552	missense	probably damaging	1.00
R0639:Adamtsl1	UTSW	4	86277143	missense	probably damaging	1.00
R0931:Adamtsl1	UTSW	4	86249847	missense	probably benign	0.05
R1186:Adamtsl1	UTSW	4	86388509	missense	probably benign	0.00
R1387:Adamtsl1	UTSW	4	86374993	splice site	probably benign
R1459:Adamtsl1	UTSW	4	86425865	missense	probably damaging	1.00
R1518:Adamtsl1	UTSW	4	86342603	missense	probably damaging	0.99
R1532:Adamtsl1	UTSW	4	86248065	missense	probably benign	0.02
R1603:Adamtsl1	UTSW	4	86415530	missense	probably benign
R1931:Adamtsl1	UTSW	4	86342411	missense	possibly damaging	0.62
R2086:Adamtsl1	UTSW	4	86228012	missense	probably damaging	1.00
R2221:Adamtsl1	UTSW	4	86388525	missense	probably benign	0.19
R2223:Adamtsl1	UTSW	4	86388525	missense	probably benign	0.19
R2396:Adamtsl1	UTSW	4	86343119	nonsense	probably null
R2397:Adamtsl1	UTSW	4	86199357	missense	probably damaging	1.00
R2426:Adamtsl1	UTSW	4	86156788	missense	probably benign	0.01
R3121:Adamtsl1	UTSW	4	86337009	missense	probably damaging	1.00
R3715:Adamtsl1	UTSW	4	86216976	missense	probably benign	0.01
R3848:Adamtsl1	UTSW	4	86418546	missense	probably damaging	1.00
R3849:Adamtsl1	UTSW	4	86418546	missense	probably damaging	1.00
R3850:Adamtsl1	UTSW	4	86418546	missense	probably damaging	1.00
R4194:Adamtsl1	UTSW	4	86054008	intron	probably benign
R4354:Adamtsl1	UTSW	4	86156684	missense	probably damaging	1.00
R4795:Adamtsl1	UTSW	4	86243769	critical splice donor site	probably null
R4830:Adamtsl1	UTSW	4	86356382	missense	probably damaging	0.97
R4874:Adamtsl1	UTSW	4	86342492	missense	possibly damaging	0.94
R4939:Adamtsl1	UTSW	4	86243725	missense	possibly damaging	0.95
R4942:Adamtsl1	UTSW	4	86341214	nonsense	probably null
R4947:Adamtsl1	UTSW	4	85764800	missense	possibly damaging	0.93
R4960:Adamtsl1	UTSW	4	86424173	nonsense	probably null
R4971:Adamtsl1	UTSW	4	86336931	missense	probably damaging	1.00
R5213:Adamtsl1	UTSW	4	86385628	missense	possibly damaging	0.89
R5237:Adamtsl1	UTSW	4	86385669	critical splice donor site	probably null
R5250:Adamtsl1	UTSW	4	86216945	nonsense	probably null
R5411:Adamtsl1	UTSW	4	86388413	critical splice acceptor site	probably null
R5554:Adamtsl1	UTSW	4	86276945	missense	possibly damaging	0.69
R5631:Adamtsl1	UTSW	4	86276923	nonsense	probably null
R5739:Adamtsl1	UTSW	4	86232664	missense	probably damaging	1.00
R5905:Adamtsl1	UTSW	4	86342324	missense	probably damaging	1.00
R6028:Adamtsl1	UTSW	4	86342324	missense	probably damaging	1.00
R6044:Adamtsl1	UTSW	4	86212691	missense	probably damaging	1.00
R6261:Adamtsl1	UTSW	4	86336878	missense	probably benign	0.09
R6300:Adamtsl1	UTSW	4	86248017	missense	probably damaging	1.00
R6332:Adamtsl1	UTSW	4	86217011	missense	probably damaging	0.96
R6560:Adamtsl1	UTSW	4	86336893	missense	probably damaging	1.00
R6693:Adamtsl1	UTSW	4	86342886	missense	probably benign	0.27
R6736:Adamtsl1	UTSW	4	86342247	missense	probably damaging	1.00
R6964:Adamtsl1	UTSW	4	86156854	missense	probably damaging	1.00
R7064:Adamtsl1	UTSW	4	86342041	missense	possibly damaging	0.80
R7434:Adamtsl1	UTSW	4	86425878	missense	probably damaging	0.99
R7477:Adamtsl1	UTSW	4	86415651	missense	probably damaging	1.00
R7545:Adamtsl1	UTSW	4	85764855	missense	probably damaging	1.00
R7556:Adamtsl1	UTSW	4	86277121	missense	probably benign	0.19
R7580:Adamtsl1	UTSW	4	86054064	missense	possibly damaging	0.53
R7593:Adamtsl1	UTSW	4	86341213	missense	probably damaging	1.00
R7710:Adamtsl1	UTSW	4	86232573	missense
R7908:Adamtsl1	UTSW	4	86356439	missense	probably benign	0.02
R7989:Adamtsl1	UTSW	4	86356439	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TTTCCGAGCTCAACAGTGTTC -3'
(R):5'- TGCCCATACCATTCACTGAAATTAC -3'

Sequencing Primer
(F):5'- GTGTTCTGCTCATAACGACGTCAAG -3'
(R):5'- TTCCTTTCAGGCAACCTG -3'

Posted On

2016-06-21