Incidental Mutation 'R5141:Cul1'
ID 396454
Institutional Source Beutler Lab
Gene Symbol Cul1
Ensembl Gene ENSMUSG00000029686
Gene Name cullin 1
Synonyms
MMRRC Submission 042727-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5141 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 47430516-47503078 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 47497773 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 618 (D618G)
Ref Sequence ENSEMBL: ENSMUSP00000122702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031697] [ENSMUST00000146200]
AlphaFold Q9WTX6
Predicted Effect probably benign
Transcript: ENSMUST00000031697
AA Change: D618G

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000031697
Gene: ENSMUSG00000029686
AA Change: D618G

DomainStartEndE-ValueType
SCOP:d1ldja2 17 410 1e-174 SMART
CULLIN 447 594 3.69e-81 SMART
low complexity region 638 651 N/A INTRINSIC
Cullin_Nedd8 703 770 6.19e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126877
Predicted Effect probably benign
Transcript: ENSMUST00000146200
AA Change: D618G

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000122702
Gene: ENSMUSG00000029686
AA Change: D618G

DomainStartEndE-ValueType
SCOP:d1ldja2 17 410 1e-176 SMART
CULLIN 447 594 3.69e-81 SMART
low complexity region 638 651 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154201
Meta Mutation Damage Score 0.0891 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (76/79)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations accumulate cyclin E1 and exhibit arrested development and lethality around embryonic day 6.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A G 14: 68,810,577 (GRCm39) V193A probably benign Het
Adamts18 T A 8: 114,501,902 (GRCm39) T320S probably damaging Het
Adamtsl1 G T 4: 86,075,087 (GRCm39) M151I possibly damaging Het
Adgrv1 A T 13: 81,419,037 (GRCm39) V5986E probably damaging Het
Aifm3 A G 16: 17,317,586 (GRCm39) E69G probably damaging Het
Akap13 C A 7: 75,259,362 (GRCm39) T662K probably benign Het
Alms1 A G 6: 85,598,414 (GRCm39) D1080G probably benign Het
Als2 T C 1: 59,209,611 (GRCm39) E1457G possibly damaging Het
Apobec4 A G 1: 152,631,964 (GRCm39) probably benign Het
Apoo-ps C T 13: 107,550,895 (GRCm39) noncoding transcript Het
Aspscr1 G A 11: 120,580,003 (GRCm39) V181I probably benign Het
Atrn T C 2: 130,841,050 (GRCm39) probably benign Het
C3 T A 17: 57,526,570 (GRCm39) I804F probably damaging Het
Cbfa2t3 C T 8: 123,361,760 (GRCm39) G421R probably benign Het
Chmp4c A G 3: 10,432,213 (GRCm39) E41G probably damaging Het
Clk4 T A 11: 51,166,598 (GRCm39) F96L possibly damaging Het
Ctsg G A 14: 56,339,184 (GRCm39) R25* probably null Het
Cylc2 T C 4: 51,228,587 (GRCm39) probably benign Het
Dip2a G A 10: 76,106,287 (GRCm39) T1326I probably damaging Het
Etnk2 A G 1: 133,296,600 (GRCm39) I210V probably benign Het
Gm5773 T A 3: 93,681,034 (GRCm39) D235E probably benign Het
Gm7353 T C 7: 3,161,001 (GRCm39) noncoding transcript Het
Gpi1 G A 7: 33,926,521 (GRCm39) probably benign Het
Ing4 T C 6: 125,016,837 (GRCm39) M5T probably benign Het
Inpp4a A G 1: 37,419,168 (GRCm39) I583V probably benign Het
Isyna1 T C 8: 71,047,543 (GRCm39) V64A probably damaging Het
Katnal2 T A 18: 77,085,337 (GRCm39) D310V probably damaging Het
Kbtbd8 A G 6: 95,098,820 (GRCm39) T126A probably damaging Het
Kif13a T C 13: 46,906,197 (GRCm39) D582G probably benign Het
Lmf2 G A 15: 89,235,810 (GRCm39) probably null Het
Lrp2 T C 2: 69,382,693 (GRCm39) probably null Het
Lrp4 T C 2: 91,309,023 (GRCm39) probably benign Het
Lyzl1 A C 18: 4,169,209 (GRCm39) D71A possibly damaging Het
Mak C T 13: 41,186,039 (GRCm39) C543Y possibly damaging Het
Mapk8ip1 T C 2: 92,217,110 (GRCm39) D404G probably damaging Het
Mdga1 C T 17: 30,071,467 (GRCm39) E385K probably benign Het
Mst1r T A 9: 107,789,440 (GRCm39) I573N probably damaging Het
Muc5ac T A 7: 141,368,479 (GRCm39) N2365K possibly damaging Het
Ncan T C 8: 70,565,487 (GRCm39) E179G probably damaging Het
Nlgn2 C T 11: 69,716,216 (GRCm39) R775H probably damaging Het
Or10d5 T G 9: 39,861,170 (GRCm39) K299T probably benign Het
Or4c122 A C 2: 89,079,473 (GRCm39) Y176* probably null Het
Or8g20 A G 9: 39,395,827 (GRCm39) F238L probably damaging Het
Pcolce G T 5: 137,604,012 (GRCm39) Q352K probably benign Het
Peg3 G T 7: 6,712,381 (GRCm39) T947N probably benign Het
Pld3 C T 7: 27,233,220 (GRCm39) D344N probably damaging Het
Plec A C 15: 76,074,733 (GRCm39) D411E probably damaging Het
Pmp2 C T 3: 10,247,474 (GRCm39) D72N probably benign Het
Ptpn9 T C 9: 56,943,960 (GRCm39) V278A possibly damaging Het
Rbm33 A G 5: 28,557,687 (GRCm39) H300R probably damaging Het
Rpgrip1l T C 8: 91,987,546 (GRCm39) Q837R probably benign Het
Rwdd4a T C 8: 48,003,709 (GRCm39) probably benign Het
Sema6a T C 18: 47,381,455 (GRCm39) T1048A probably damaging Het
Senp1 G A 15: 97,974,488 (GRCm39) A108V probably benign Het
Serpine2 G T 1: 79,780,580 (GRCm39) Q290K possibly damaging Het
Sesn1 A G 10: 41,687,097 (GRCm39) N27S probably benign Het
Shroom1 T A 11: 53,354,809 (GRCm39) L243* probably null Het
Slc17a5 A G 9: 78,448,270 (GRCm39) Y395H probably damaging Het
Slc5a8 T C 10: 88,755,422 (GRCm39) probably null Het
Sptbn5 G A 2: 119,892,212 (GRCm39) S1083F probably benign Het
Stx4a T A 7: 127,445,787 (GRCm39) V231E probably damaging Het
Swt1 A T 1: 151,287,145 (GRCm39) S116T probably benign Het
Syt9 C T 7: 107,103,426 (GRCm39) T408I probably damaging Het
Tgm7 T C 2: 120,931,480 (GRCm39) T228A probably benign Het
Tmem115 A G 9: 107,415,141 (GRCm39) D310G probably benign Het
Trcg1 G A 9: 57,148,587 (GRCm39) G53D probably damaging Het
Tsfm T C 10: 126,865,482 (GRCm39) K100E probably damaging Het
Usp1 A G 4: 98,822,446 (GRCm39) T587A probably damaging Het
Vcpip1 G T 1: 9,818,302 (GRCm39) A27E unknown Het
Vmn2r49 T C 7: 9,720,300 (GRCm39) N397S probably benign Het
Vmn2r8 A G 5: 108,956,572 (GRCm39) S17P probably damaging Het
Vwa3b A G 1: 37,226,102 (GRCm39) probably benign Het
Ythdc2 T A 18: 44,998,114 (GRCm39) S1094T probably benign Het
Zbtb22 C G 17: 34,137,610 (GRCm39) S585C possibly damaging Het
Zhx2 A G 15: 57,685,182 (GRCm39) T184A probably benign Het
Other mutations in Cul1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Cul1 APN 6 47,485,978 (GRCm39) missense probably benign
IGL02410:Cul1 APN 6 47,461,948 (GRCm39) missense probably damaging 1.00
IGL02458:Cul1 APN 6 47,502,542 (GRCm39) missense possibly damaging 0.91
IGL02490:Cul1 APN 6 47,491,820 (GRCm39) missense probably damaging 0.98
IGL03065:Cul1 APN 6 47,472,015 (GRCm39) missense probably damaging 1.00
IGL03387:Cul1 APN 6 47,478,143 (GRCm39) missense probably damaging 0.96
IGL02837:Cul1 UTSW 6 47,500,139 (GRCm39) missense probably benign 0.01
R0064:Cul1 UTSW 6 47,479,349 (GRCm39) splice site probably benign
R0064:Cul1 UTSW 6 47,479,349 (GRCm39) splice site probably benign
R0436:Cul1 UTSW 6 47,500,707 (GRCm39) missense probably benign 0.16
R0746:Cul1 UTSW 6 47,495,222 (GRCm39) splice site probably null
R1103:Cul1 UTSW 6 47,494,111 (GRCm39) missense probably benign 0.03
R1471:Cul1 UTSW 6 47,491,820 (GRCm39) missense probably damaging 0.98
R1746:Cul1 UTSW 6 47,485,179 (GRCm39) missense probably damaging 0.98
R1852:Cul1 UTSW 6 47,497,764 (GRCm39) missense probably damaging 0.99
R1858:Cul1 UTSW 6 47,502,458 (GRCm39) splice site probably null
R1937:Cul1 UTSW 6 47,485,289 (GRCm39) missense probably benign 0.19
R1964:Cul1 UTSW 6 47,479,505 (GRCm39) missense probably damaging 0.98
R2985:Cul1 UTSW 6 47,479,441 (GRCm39) missense probably damaging 1.00
R4452:Cul1 UTSW 6 47,485,923 (GRCm39) nonsense probably null
R4653:Cul1 UTSW 6 47,461,897 (GRCm39) missense probably damaging 1.00
R4860:Cul1 UTSW 6 47,494,080 (GRCm39) missense probably benign 0.38
R4860:Cul1 UTSW 6 47,494,080 (GRCm39) missense probably benign 0.38
R4860:Cul1 UTSW 6 47,494,125 (GRCm39) missense probably damaging 0.99
R4860:Cul1 UTSW 6 47,494,125 (GRCm39) missense probably damaging 0.99
R5328:Cul1 UTSW 6 47,485,251 (GRCm39) missense probably damaging 0.99
R5399:Cul1 UTSW 6 47,462,018 (GRCm39) splice site probably null
R5593:Cul1 UTSW 6 47,491,925 (GRCm39) missense probably damaging 0.99
R5593:Cul1 UTSW 6 47,462,020 (GRCm39) nonsense probably null
R5616:Cul1 UTSW 6 47,500,722 (GRCm39) missense probably damaging 1.00
R5855:Cul1 UTSW 6 47,500,147 (GRCm39) missense probably benign 0.00
R6382:Cul1 UTSW 6 47,479,373 (GRCm39) missense probably damaging 1.00
R6670:Cul1 UTSW 6 47,494,068 (GRCm39) missense probably damaging 1.00
R6964:Cul1 UTSW 6 47,493,443 (GRCm39) missense probably benign 0.01
R8146:Cul1 UTSW 6 47,472,027 (GRCm39) missense possibly damaging 0.50
R8373:Cul1 UTSW 6 47,491,997 (GRCm39) missense possibly damaging 0.78
R8842:Cul1 UTSW 6 47,492,010 (GRCm39) missense probably damaging 1.00
R8899:Cul1 UTSW 6 47,474,246 (GRCm39) missense possibly damaging 0.84
R9093:Cul1 UTSW 6 47,495,173 (GRCm39) missense probably damaging 1.00
R9352:Cul1 UTSW 6 47,479,426 (GRCm39) missense probably benign 0.00
RF001:Cul1 UTSW 6 47,501,515 (GRCm39) missense possibly damaging 0.50
RF055:Cul1 UTSW 6 47,494,067 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGTCCATTCCCCTGGTTG -3'
(R):5'- GGATCTATCTGGCCTGGTCTTC -3'

Sequencing Primer
(F):5'- CCCCTGGTTGTGACATTTTG -3'
(R):5'- GCCTTGGTCAGAGTTTACTGC -3'
Posted On 2016-06-21