Incidental Mutation 'R5141:Stx4a'
ID396465
Institutional Source Beutler Lab
Gene Symbol Stx4a
Ensembl Gene ENSMUSG00000030805
Gene Namesyntaxin 4A (placental)
SynonymsSyn4, Syn-4, Stx4
MMRRC Submission 042727-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5141 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127824294-127849019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127846615 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 231 (V231E)
Ref Sequence ENSEMBL: ENSMUSP00000112927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033075] [ENSMUST00000121705] [ENSMUST00000156537]
Predicted Effect probably damaging
Transcript: ENSMUST00000033075
AA Change: V231E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033075
Gene: ENSMUSG00000030805
AA Change: V231E

DomainStartEndE-ValueType
SynN 33 153 2.6e-34 SMART
t_SNARE 195 262 3.8e-20 SMART
transmembrane domain 274 296 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121705
AA Change: V231E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112927
Gene: ENSMUSG00000030805
AA Change: V231E

DomainStartEndE-ValueType
SynN 33 153 2.6e-34 SMART
t_SNARE 195 262 3.8e-20 SMART
transmembrane domain 274 296 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125861
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152310
Predicted Effect probably benign
Transcript: ENSMUST00000156537
Meta Mutation Damage Score 0.9735 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (76/79)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null allele die in early embyonic stages. Heterozygous mice exhibit abnormalities in glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A G 14: 68,573,128 V193A probably benign Het
Adamts18 T A 8: 113,775,270 T320S probably damaging Het
Adamtsl1 G T 4: 86,156,850 M151I possibly damaging Het
Adgrv1 A T 13: 81,270,918 V5986E probably damaging Het
Aifm3 A G 16: 17,499,722 E69G probably damaging Het
Akap13 C A 7: 75,609,614 T662K probably benign Het
Alms1 A G 6: 85,621,432 D1080G probably benign Het
Als2 T C 1: 59,170,452 E1457G possibly damaging Het
Apobec4 A G 1: 152,756,213 probably benign Het
Apoo-ps C T 13: 107,414,395 noncoding transcript Het
Aspscr1 G A 11: 120,689,177 V181I probably benign Het
Atrn T C 2: 130,999,130 probably benign Het
C3 T A 17: 57,219,570 I804F probably damaging Het
Cbfa2t3 C T 8: 122,635,021 G421R probably benign Het
Chmp4c A G 3: 10,367,153 E41G probably damaging Het
Clk4 T A 11: 51,275,771 F96L possibly damaging Het
Ctsg G A 14: 56,101,727 R25* probably null Het
Cul1 A G 6: 47,520,839 D618G probably benign Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dip2a G A 10: 76,270,453 T1326I probably damaging Het
Etnk2 A G 1: 133,368,862 I210V probably benign Het
Gm5773 T A 3: 93,773,727 D235E probably benign Het
Gm7353 T C 7: 3,111,001 noncoding transcript Het
Gpi1 G A 7: 34,227,096 probably benign Het
Ing4 T C 6: 125,039,874 M5T probably benign Het
Inpp4a A G 1: 37,380,087 I583V probably benign Het
Isyna1 T C 8: 70,594,893 V64A probably damaging Het
Katnal2 T A 18: 76,997,641 D310V probably damaging Het
Kbtbd8 A G 6: 95,121,839 T126A probably damaging Het
Kif13a T C 13: 46,752,721 D582G probably benign Het
Lmf2 G A 15: 89,351,607 probably null Het
Lrp2 T C 2: 69,552,349 probably null Het
Lrp4 T C 2: 91,478,678 probably benign Het
Lyzl1 A C 18: 4,169,209 D71A possibly damaging Het
Mak C T 13: 41,032,563 C543Y possibly damaging Het
Mapk8ip1 T C 2: 92,386,765 D404G probably damaging Het
Mdga1 C T 17: 29,852,493 E385K probably benign Het
Mst1r T A 9: 107,912,241 I573N probably damaging Het
Muc5ac T A 7: 141,814,742 N2365K possibly damaging Het
Ncan T C 8: 70,112,837 E179G probably damaging Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1228 A C 2: 89,249,129 Y176* probably null Het
Olfr44 A G 9: 39,484,531 F238L probably damaging Het
Olfr975 T G 9: 39,949,874 K299T probably benign Het
Pcolce G T 5: 137,605,750 Q352K probably benign Het
Peg3 G T 7: 6,709,382 T947N probably benign Het
Pld3 C T 7: 27,533,795 D344N probably damaging Het
Plec A C 15: 76,190,533 D411E probably damaging Het
Pmp2 C T 3: 10,182,414 D72N probably benign Het
Ptpn9 T C 9: 57,036,676 V278A possibly damaging Het
Rbm33 A G 5: 28,352,689 H300R probably damaging Het
Rpgrip1l T C 8: 91,260,918 Q837R probably benign Het
Rwdd4a T C 8: 47,550,674 probably benign Het
Sema6a T C 18: 47,248,388 T1048A probably damaging Het
Senp1 G A 15: 98,076,607 A108V probably benign Het
Serpine2 G T 1: 79,802,863 Q290K possibly damaging Het
Sesn1 A G 10: 41,811,101 N27S probably benign Het
Shroom1 T A 11: 53,463,982 L243* probably null Het
Slc17a5 A G 9: 78,540,988 Y395H probably damaging Het
Slc5a8 T C 10: 88,919,560 probably null Het
Sptbn5 G A 2: 120,061,731 S1083F probably benign Het
Swt1 A T 1: 151,411,394 S116T probably benign Het
Syt9 C T 7: 107,504,219 T408I probably damaging Het
Tgm7 T C 2: 121,100,999 T228A probably benign Het
Tmem115 A G 9: 107,537,942 D310G probably benign Het
Trcg1 G A 9: 57,241,304 G53D probably damaging Het
Tsfm T C 10: 127,029,613 K100E probably damaging Het
Usp1 A G 4: 98,934,209 T587A probably damaging Het
Vcpip1 G T 1: 9,748,077 A27E unknown Het
Vmn2r49 T C 7: 9,986,373 N397S probably benign Het
Vmn2r8 A G 5: 108,808,706 S17P probably damaging Het
Vwa3b A G 1: 37,187,021 probably benign Het
Ythdc2 T A 18: 44,865,047 S1094T probably benign Het
Zbtb22 C G 17: 33,918,636 S585C possibly damaging Het
Zhx2 A G 15: 57,821,786 T184A probably benign Het
Other mutations in Stx4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Stx4a APN 7 127842726 missense probably benign 0.01
IGL02089:Stx4a APN 7 127848398 missense probably damaging 1.00
IGL02220:Stx4a APN 7 127842500 missense possibly damaging 0.94
Schaum UTSW 7 127846615 missense probably damaging 1.00
R4902:Stx4a UTSW 7 127842762 splice site probably null
R5930:Stx4a UTSW 7 127846489 missense probably damaging 1.00
R6421:Stx4a UTSW 7 127846501 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTTGAGAACCAGGTGCTG -3'
(R):5'- AGCCATGACTAAGGCCATGC -3'

Sequencing Primer
(F):5'- GCTGGTGTCCCTGTGAC -3'
(R):5'- TGGCTCAGGAGGGATGC -3'
Posted On2016-06-21