Mutagenetix > Incidental Mutation

Incidental Mutation 'R5141:Muc5ac'

396466

Institutional Source

Beutler Lab

Gene Symbol

Muc5ac

Ensembl Gene

ENSMUSG00000037974

Gene Name

mucin 5, subtypes A and C, tracheobronchial/gastric

Synonyms

MGM, 2210005L13Rik

MMRRC Submission

042727-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5141 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

141788972-141819231 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 141814742 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 2365 (N2365K)

Ref Sequence

ENSEMBL: ENSMUSP00000131681 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041924] [ENSMUST00000155534] [ENSMUST00000163321]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041924
AA Change: N2365K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000039699
Gene: ENSMUSG00000037974
AA Change: N2365K

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
VWD	69	226	4.19e-30	SMART
C8	258	334	1.34e-11	SMART
Pfam:TIL	337	393	1.6e-14	PFAM
VWC	395	462	8.6e-18	SMART
VWD	421	585	1.55e-33	SMART
C8	622	696	8.42e-36	SMART
Pfam:TIL	702	759	6.1e-9	PFAM
VWC	761	825	6.75e-1	SMART
VWC	863	905	4.06e-1	SMART
VWD	890	1050	1.51e-45	SMART
C8	1086	1160	2.78e-36	SMART
low complexity region	1315	1330	N/A	INTRINSIC
low complexity region	1333	1366	N/A	INTRINSIC
low complexity region	1371	1387	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1394	1482	2.3e-25	PFAM
low complexity region	1521	1532	N/A	INTRINSIC
low complexity region	1536	1563	N/A	INTRINSIC
low complexity region	1578	1595	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1604	1692	2.2e-27	PFAM
Pfam:Mucin2_WxxW	1765	1857	8.6e-27	PFAM
low complexity region	1875	1895	N/A	INTRINSIC
low complexity region	1949	1968	N/A	INTRINSIC
VWD	2030	2199	4.17e-48	SMART
C8	2242	2311	3.95e-9	SMART
VWC	2376	2439	1.04e-11	SMART
VWC	2479	2543	9.31e-5	SMART
CT	2625	2711	3.43e-32	SMART
low complexity region	2720	2733	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000155534
AA Change: N3069K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000122353
Gene: ENSMUSG00000037974
AA Change: N3069K

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
VWD	69	226	4.19e-30	SMART
C8	258	334	1.34e-11	SMART
Pfam:TIL	337	393	9.6e-15	PFAM
VWC	395	437	3.54e-1	SMART
VWD	422	586	2.35e-33	SMART
C8	623	697	8.42e-36	SMART
Pfam:TIL	703	760	3.6e-9	PFAM
VWC	762	826	6.75e-1	SMART
VWC	864	906	4.06e-1	SMART
VWD	891	1051	1.51e-45	SMART
C8	1087	1161	2.78e-36	SMART
low complexity region	1316	1331	N/A	INTRINSIC
low complexity region	1334	1367	N/A	INTRINSIC
low complexity region	1372	1388	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1395	1483	1.3e-25	PFAM
low complexity region	1522	1533	N/A	INTRINSIC
low complexity region	1537	1564	N/A	INTRINSIC
low complexity region	1579	1596	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1605	1693	1.3e-27	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163321
AA Change: N2365K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000131681
Gene: ENSMUSG00000037974
AA Change: N2365K

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
VWD	69	226	4.19e-30	SMART
C8	258	334	1.34e-11	SMART
Pfam:TIL	337	393	7.9e-15	PFAM
VWC	395	462	8.6e-18	SMART
VWD	421	585	1.55e-33	SMART
C8	622	696	8.42e-36	SMART
Pfam:TIL	702	759	1.9e-9	PFAM
VWC	761	825	6.75e-1	SMART
VWC	863	905	4.06e-1	SMART
VWD	890	1050	1.51e-45	SMART
C8	1086	1160	2.78e-36	SMART
low complexity region	1315	1330	N/A	INTRINSIC
low complexity region	1333	1366	N/A	INTRINSIC
low complexity region	1371	1387	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1394	1481	1.1e-23	PFAM
low complexity region	1521	1532	N/A	INTRINSIC
low complexity region	1536	1563	N/A	INTRINSIC
low complexity region	1578	1595	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1604	1691	1.1e-25	PFAM
Pfam:Mucin2_WxxW	1765	1856	6.3e-24	PFAM
low complexity region	1875	1895	N/A	INTRINSIC
low complexity region	1949	1968	N/A	INTRINSIC
VWD	2030	2199	4.17e-48	SMART
C8	2242	2311	3.95e-9	SMART
VWC	2376	2439	1.04e-11	SMART
VWC	2479	2543	9.31e-5	SMART
CT	2625	2711	3.43e-32	SMART
low complexity region	2720	2733	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

96% (76/79)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to T. muris infection with persistent worm burden, goblet cell hyperplasia, and increased serum IFN-gamma despite a normal TH2-type immune response. A portion of mice show corneal opacity and poor tear quality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamdec1	A	G	14: 68,573,128	V193A	probably benign	Het
Adamts18	T	A	8: 113,775,270	T320S	probably damaging	Het
Adamtsl1	G	T	4: 86,156,850	M151I	possibly damaging	Het
Adgrv1	A	T	13: 81,270,918	V5986E	probably damaging	Het
Aifm3	A	G	16: 17,499,722	E69G	probably damaging	Het
Akap13	C	A	7: 75,609,614	T662K	probably benign	Het
Alms1	A	G	6: 85,621,432	D1080G	probably benign	Het
Als2	T	C	1: 59,170,452	E1457G	possibly damaging	Het
Apobec4	A	G	1: 152,756,213		probably benign	Het
Apoo-ps	C	T	13: 107,414,395		noncoding transcript	Het
Aspscr1	G	A	11: 120,689,177	V181I	probably benign	Het
Atrn	T	C	2: 130,999,130		probably benign	Het
C3	T	A	17: 57,219,570	I804F	probably damaging	Het
Cbfa2t3	C	T	8: 122,635,021	G421R	probably benign	Het
Chmp4c	A	G	3: 10,367,153	E41G	probably damaging	Het
Clk4	T	A	11: 51,275,771	F96L	possibly damaging	Het
Ctsg	G	A	14: 56,101,727	R25*	probably null	Het
Cul1	A	G	6: 47,520,839	D618G	probably benign	Het
Cylc2	T	C	4: 51,228,587		probably benign	Het
Dip2a	G	A	10: 76,270,453	T1326I	probably damaging	Het
Etnk2	A	G	1: 133,368,862	I210V	probably benign	Het
Gm5773	T	A	3: 93,773,727	D235E	probably benign	Het
Gm7353	T	C	7: 3,111,001		noncoding transcript	Het
Gpi1	G	A	7: 34,227,096		probably benign	Het
Ing4	T	C	6: 125,039,874	M5T	probably benign	Het
Inpp4a	A	G	1: 37,380,087	I583V	probably benign	Het
Isyna1	T	C	8: 70,594,893	V64A	probably damaging	Het
Katnal2	T	A	18: 76,997,641	D310V	probably damaging	Het
Kbtbd8	A	G	6: 95,121,839	T126A	probably damaging	Het
Kif13a	T	C	13: 46,752,721	D582G	probably benign	Het
Lmf2	G	A	15: 89,351,607		probably null	Het
Lrp2	T	C	2: 69,552,349		probably null	Het
Lrp4	T	C	2: 91,478,678		probably benign	Het
Lyzl1	A	C	18: 4,169,209	D71A	possibly damaging	Het
Mak	C	T	13: 41,032,563	C543Y	possibly damaging	Het
Mapk8ip1	T	C	2: 92,386,765	D404G	probably damaging	Het
Mdga1	C	T	17: 29,852,493	E385K	probably benign	Het
Mst1r	T	A	9: 107,912,241	I573N	probably damaging	Het
Ncan	T	C	8: 70,112,837	E179G	probably damaging	Het
Nlgn2	C	T	11: 69,825,390	R775H	probably damaging	Het
Olfr1228	A	C	2: 89,249,129	Y176*	probably null	Het
Olfr44	A	G	9: 39,484,531	F238L	probably damaging	Het
Olfr975	T	G	9: 39,949,874	K299T	probably benign	Het
Pcolce	G	T	5: 137,605,750	Q352K	probably benign	Het
Peg3	G	T	7: 6,709,382	T947N	probably benign	Het
Pld3	C	T	7: 27,533,795	D344N	probably damaging	Het
Plec	A	C	15: 76,190,533	D411E	probably damaging	Het
Pmp2	C	T	3: 10,182,414	D72N	probably benign	Het
Ptpn9	T	C	9: 57,036,676	V278A	possibly damaging	Het
Rbm33	A	G	5: 28,352,689	H300R	probably damaging	Het
Rpgrip1l	T	C	8: 91,260,918	Q837R	probably benign	Het
Rwdd4a	T	C	8: 47,550,674		probably benign	Het
Sema6a	T	C	18: 47,248,388	T1048A	probably damaging	Het
Senp1	G	A	15: 98,076,607	A108V	probably benign	Het
Serpine2	G	T	1: 79,802,863	Q290K	possibly damaging	Het
Sesn1	A	G	10: 41,811,101	N27S	probably benign	Het
Shroom1	T	A	11: 53,463,982	L243*	probably null	Het
Slc17a5	A	G	9: 78,540,988	Y395H	probably damaging	Het
Slc5a8	T	C	10: 88,919,560		probably null	Het
Sptbn5	G	A	2: 120,061,731	S1083F	probably benign	Het
Stx4a	T	A	7: 127,846,615	V231E	probably damaging	Het
Swt1	A	T	1: 151,411,394	S116T	probably benign	Het
Syt9	C	T	7: 107,504,219	T408I	probably damaging	Het
Tgm7	T	C	2: 121,100,999	T228A	probably benign	Het
Tmem115	A	G	9: 107,537,942	D310G	probably benign	Het
Trcg1	G	A	9: 57,241,304	G53D	probably damaging	Het
Tsfm	T	C	10: 127,029,613	K100E	probably damaging	Het
Usp1	A	G	4: 98,934,209	T587A	probably damaging	Het
Vcpip1	G	T	1: 9,748,077	A27E	unknown	Het
Vmn2r49	T	C	7: 9,986,373	N397S	probably benign	Het
Vmn2r8	A	G	5: 108,808,706	S17P	probably damaging	Het
Vwa3b	A	G	1: 37,187,021		probably benign	Het
Ythdc2	T	A	18: 44,865,047	S1094T	probably benign	Het
Zbtb22	C	G	17: 33,918,636	S585C	possibly damaging	Het
Zhx2	A	G	15: 57,821,786	T184A	probably benign	Het

Other mutations in Muc5ac

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00899:Muc5ac	APN	7	141812703	missense	possibly damaging	0.93
IGL01064:Muc5ac	APN	7	141807473	missense	probably benign	0.12
IGL01155:Muc5ac	APN	7	141806943	splice site	probably benign
IGL01452:Muc5ac	APN	7	141817555	missense	probably benign	0.00
IGL01590:Muc5ac	APN	7	141798893	missense	probably benign	0.02
IGL02104:Muc5ac	APN	7	141811078	missense	probably damaging	0.98
IGL02152:Muc5ac	APN	7	141800177	missense	possibly damaging	0.86
IGL02153:Muc5ac	APN	7	141818800	nonsense	probably null
IGL02178:Muc5ac	APN	7	141805447	splice site	probably benign
IGL02403:Muc5ac	APN	7	141803450	missense	possibly damaging	0.71
IGL02576:Muc5ac	APN	7	141817044	missense	probably benign	0.01
IGL02665:Muc5ac	APN	7	141791086	missense	possibly damaging	0.71
IGL02704:Muc5ac	APN	7	141795263	missense	possibly damaging	0.71
IGL02808:Muc5ac	APN	7	141805775	missense	possibly damaging	0.72
IGL03283:Muc5ac	APN	7	141813781	missense	probably benign	0.34
IGL03384:Muc5ac	APN	7	141812403	missense	possibly damaging	0.71
IGL03046:Muc5ac	UTSW	7	141795213	missense	probably benign	0.27
PIT4515001:Muc5ac	UTSW	7	141807416	missense	probably damaging	0.99
R0092:Muc5ac	UTSW	7	141818630	missense	possibly damaging	0.72
R0145:Muc5ac	UTSW	7	141795275	missense	possibly damaging	0.71
R0147:Muc5ac	UTSW	7	141811039	missense	probably benign	0.08
R0363:Muc5ac	UTSW	7	141800960	missense	probably benign	0.01
R0384:Muc5ac	UTSW	7	141812251	missense	possibly damaging	0.71
R0440:Muc5ac	UTSW	7	141792034	nonsense	probably null
R0583:Muc5ac	UTSW	7	141807608	missense	probably damaging	0.99
R0616:Muc5ac	UTSW	7	141796244	missense	probably benign	0.02
R0682:Muc5ac	UTSW	7	141805669	missense	possibly damaging	0.53
R0685:Muc5ac	UTSW	7	141807709	missense	probably benign	0.03
R0883:Muc5ac	UTSW	7	141796265	missense	possibly damaging	0.71
R0924:Muc5ac	UTSW	7	141807515	missense	possibly damaging	0.68
R1300:Muc5ac	UTSW	7	141816929	missense	possibly damaging	0.73
R1315:Muc5ac	UTSW	7	141807323	missense	probably damaging	0.99
R1354:Muc5ac	UTSW	7	141807377	missense	probably damaging	0.99
R1484:Muc5ac	UTSW	7	141813892	splice site	probably null
R1599:Muc5ac	UTSW	7	141798903	missense	possibly damaging	0.52
R1758:Muc5ac	UTSW	7	141801531	missense	possibly damaging	0.86
R1837:Muc5ac	UTSW	7	141807086	missense	probably benign	0.00
R1911:Muc5ac	UTSW	7	141796304	missense	probably benign	0.18
R1922:Muc5ac	UTSW	7	141793689	missense	probably benign	0.03
R1966:Muc5ac	UTSW	7	141803376	missense	possibly damaging	0.92
R1994:Muc5ac	UTSW	7	141813152	missense	possibly damaging	0.93
R2056:Muc5ac	UTSW	7	141792035	missense	probably benign	0.01
R2126:Muc5ac	UTSW	7	141810742	missense	possibly damaging	0.84
R2170:Muc5ac	UTSW	7	141812347	missense	possibly damaging	0.93
R2258:Muc5ac	UTSW	7	141791008	missense	probably benign	0.41
R2259:Muc5ac	UTSW	7	141791008	missense	probably benign	0.41
R2293:Muc5ac	UTSW	7	141807199	missense	probably damaging	0.99
R2435:Muc5ac	UTSW	7	141818104	missense	possibly damaging	0.53
R2895:Muc5ac	UTSW	7	141791140	missense	possibly damaging	0.92
R2910:Muc5ac	UTSW	7	141807641	missense	probably damaging	0.99
R3154:Muc5ac	UTSW	7	141792736	splice site	probably null
R3762:Muc5ac	UTSW	7	141807475	missense	possibly damaging	0.53
R3791:Muc5ac	UTSW	7	141798501	missense	probably benign	0.32
R3806:Muc5ac	UTSW	7	141813734	missense	possibly damaging	0.91
R3825:Muc5ac	UTSW	7	141814723	missense	possibly damaging	0.92
R3888:Muc5ac	UTSW	7	141791224	missense	possibly damaging	0.51
R3929:Muc5ac	UTSW	7	141802892	missense	probably benign
R3981:Muc5ac	UTSW	7	141813775	missense	possibly damaging	0.86
R4034:Muc5ac	UTSW	7	141799844	critical splice donor site	probably null
R4043:Muc5ac	UTSW	7	141807478	missense	possibly damaging	0.53
R4061:Muc5ac	UTSW	7	141811130	missense	possibly damaging	0.85
R4106:Muc5ac	UTSW	7	141802835	missense	possibly damaging	0.86
R4206:Muc5ac	UTSW	7	141817110	missense	possibly damaging	0.73
R4613:Muc5ac	UTSW	7	141791103	missense	possibly damaging	0.93
R4719:Muc5ac	UTSW	7	141789763	missense	possibly damaging	0.83
R4751:Muc5ac	UTSW	7	141817601	missense	probably benign	0.00
R4789:Muc5ac	UTSW	7	141798882	missense	possibly damaging	0.86
R4928:Muc5ac	UTSW	7	141817902	nonsense	probably null
R4971:Muc5ac	UTSW	7	141816278	missense	possibly damaging	0.68
R4982:Muc5ac	UTSW	7	141809456	intron	probably benign
R5088:Muc5ac	UTSW	7	141796319	missense	possibly damaging	0.53
R5224:Muc5ac	UTSW	7	141793971	missense	probably benign	0.32
R5366:Muc5ac	UTSW	7	141807550	missense	probably benign	0.01
R5497:Muc5ac	UTSW	7	141807643	missense	probably damaging	0.99
R5507:Muc5ac	UTSW	7	141807832	missense	possibly damaging	0.72
R5643:Muc5ac	UTSW	7	141793715	critical splice donor site	probably null
R5811:Muc5ac	UTSW	7	141798984	missense	possibly damaging	0.51
R5946:Muc5ac	UTSW	7	141817907	missense	possibly damaging	0.73
R5970:Muc5ac	UTSW	7	141790669	nonsense	probably null
R5977:Muc5ac	UTSW	7	141796367	missense	possibly damaging	0.73
R6051:Muc5ac	UTSW	7	141811857	missense	possibly damaging	0.53
R6126:Muc5ac	UTSW	7	141801232	missense	possibly damaging	0.71
R6159:Muc5ac	UTSW	7	141815586	missense	possibly damaging	0.53
R6256:Muc5ac	UTSW	7	141789795	missense	possibly damaging	0.53
R6283:Muc5ac	UTSW	7	141816864	nonsense	probably null
R6341:Muc5ac	UTSW	7	141801492	missense	probably damaging	0.99
R6356:Muc5ac	UTSW	7	141812679	missense	probably benign	0.05
R6481:Muc5ac	UTSW	7	141809071	intron	probably benign
R6483:Muc5ac	UTSW	7	141802854	missense	probably benign	0.18
R6627:Muc5ac	UTSW	7	141808690	intron	probably benign
R6636:Muc5ac	UTSW	7	141818605	missense	possibly damaging	0.86
R6637:Muc5ac	UTSW	7	141818605	missense	possibly damaging	0.86
R6656:Muc5ac	UTSW	7	141803328	missense	probably damaging	0.98
R6721:Muc5ac	UTSW	7	141798992	missense	possibly damaging	0.71
R6794:Muc5ac	UTSW	7	141809552	intron	probably benign
R6844:Muc5ac	UTSW	7	141809744	intron	probably benign
R6847:Muc5ac	UTSW	7	141809744	intron	probably benign
R6852:Muc5ac	UTSW	7	141816907	missense	probably benign	0.03
R6862:Muc5ac	UTSW	7	141809744	intron	probably benign
R6863:Muc5ac	UTSW	7	141809744	intron	probably benign
R6864:Muc5ac	UTSW	7	141809744	intron	probably benign
R6865:Muc5ac	UTSW	7	141809744	intron	probably benign
R6874:Muc5ac	UTSW	7	141809744	intron	probably benign
R6875:Muc5ac	UTSW	7	141809744	intron	probably benign
R6876:Muc5ac	UTSW	7	141809744	intron	probably benign
R6877:Muc5ac	UTSW	7	141809744	intron	probably benign
R6889:Muc5ac	UTSW	7	141809744	intron	probably benign
R6920:Muc5ac	UTSW	7	141793298	missense	possibly damaging	0.86
R6998:Muc5ac	UTSW	7	141818714	missense	possibly damaging	0.92
R7017:Muc5ac	UTSW	7	141809687	intron	probably benign
R7091:Muc5ac	UTSW	7	141809687	intron	probably benign
R7092:Muc5ac	UTSW	7	141809648	intron	probably benign
R7092:Muc5ac	UTSW	7	141809687	intron	probably benign
R7110:Muc5ac	UTSW	7	141799822	missense	possibly damaging	0.95
R7117:Muc5ac	UTSW	7	141813822	nonsense	probably null
R7238:Muc5ac	UTSW	7	141809517	missense	unknown
R7238:Muc5ac	UTSW	7	141809687	intron	probably benign
R7396:Muc5ac	UTSW	7	141808415	missense	unknown
R7456:Muc5ac	UTSW	7	141793167	missense	probably benign	0.32
R7477:Muc5ac	UTSW	7	141816282	missense	possibly damaging	0.72
R7530:Muc5ac	UTSW	7	141813799	missense	possibly damaging	0.51
R7545:Muc5ac	UTSW	7	141808668	missense	unknown
R7604:Muc5ac	UTSW	7	141809709	missense	unknown
R7635:Muc5ac	UTSW	7	141805676	missense	probably damaging	0.98
R7635:Muc5ac	UTSW	7	141805753	missense	possibly damaging	0.53
R7650:Muc5ac	UTSW	7	141809422	missense	unknown
R7651:Muc5ac	UTSW	7	141796254	missense	possibly damaging	0.92
R7685:Muc5ac	UTSW	7	141809383	missense	unknown
R7720:Muc5ac	UTSW	7	141809303	missense	unknown
R7749:Muc5ac	UTSW	7	141809303	missense	unknown
R7750:Muc5ac	UTSW	7	141809303	missense	unknown
R7751:Muc5ac	UTSW	7	141809303	missense	unknown
R7754:Muc5ac	UTSW	7	141809303	missense	unknown
R7798:Muc5ac	UTSW	7	141794041	critical splice donor site	probably null
R7835:Muc5ac	UTSW	7	141809303	missense	unknown
R7837:Muc5ac	UTSW	7	141815963	missense	possibly damaging	0.53
R7858:Muc5ac	UTSW	7	141803429	missense	possibly damaging	0.51
R7866:Muc5ac	UTSW	7	141795852	missense	probably benign	0.00
R7874:Muc5ac	UTSW	7	141809303	missense	unknown
R7876:Muc5ac	UTSW	7	141809303	missense	unknown
R7877:Muc5ac	UTSW	7	141809303	missense	unknown
R7881:Muc5ac	UTSW	7	141809303	missense	unknown
R7884:Muc5ac	UTSW	7	141809303	missense	unknown
R7921:Muc5ac	UTSW	7	141809687	intron	probably benign
R7976:Muc5ac	UTSW	7	141809791	missense	unknown
R8104:Muc5ac	UTSW	7	141804783	missense	possibly damaging	0.96
R8177:Muc5ac	UTSW	7	141807331	missense	probably damaging	1.00
R8214:Muc5ac	UTSW	7	141802948	missense	possibly damaging	0.53
R8292:Muc5ac	UTSW	7	141809263	missense	unknown
R8386:Muc5ac	UTSW	7	141807634	missense	possibly damaging	0.93
R8400:Muc5ac	UTSW	7	141810476	missense	probably damaging	0.99
R8504:Muc5ac	UTSW	7	141807155	missense	probably damaging	1.00
R8709:Muc5ac	UTSW	7	141816926	missense	possibly damaging	0.96
R8725:Muc5ac	UTSW	7	141809744	intron	probably benign
R8727:Muc5ac	UTSW	7	141809744	intron	probably benign
R8754:Muc5ac	UTSW	7	141800271	missense	possibly damaging	0.85
R8769:Muc5ac	UTSW	7	141818872	missense	probably damaging	1.00
R8933:Muc5ac	UTSW	7	141789756	missense	possibly damaging	0.59
R8939:Muc5ac	UTSW	7	141793354	missense	probably damaging	0.98
R9049:Muc5ac	UTSW	7	141808975	missense	unknown
R9124:Muc5ac	UTSW	7	141809792	missense	unknown
R9131:Muc5ac	UTSW	7	141809792	missense	unknown
R9132:Muc5ac	UTSW	7	141809792	missense	unknown
R9135:Muc5ac	UTSW	7	141798481	missense	probably damaging	0.99
R9156:Muc5ac	UTSW	7	141809792	missense	unknown
R9157:Muc5ac	UTSW	7	141809792	missense	unknown
R9159:Muc5ac	UTSW	7	141809792	missense	unknown
R9160:Muc5ac	UTSW	7	141809792	missense	unknown
R9161:Muc5ac	UTSW	7	141799289	missense	possibly damaging	0.53
R9175:Muc5ac	UTSW	7	141812356	missense	possibly damaging	0.92
R9183:Muc5ac	UTSW	7	141798900	missense	possibly damaging	0.71
R9218:Muc5ac	UTSW	7	141807361	missense	probably damaging	0.99
R9219:Muc5ac	UTSW	7	141817063	nonsense	probably null
R9239:Muc5ac	UTSW	7	141800217	missense	probably damaging	0.99
R9246:Muc5ac	UTSW	7	141810478	missense	probably benign	0.11
R9287:Muc5ac	UTSW	7	141807889	missense	probably damaging	0.99
R9320:Muc5ac	UTSW	7	141815518	missense	probably benign	0.01
R9327:Muc5ac	UTSW	7	141811692	missense	possibly damaging	0.86
R9428:Muc5ac	UTSW	7	141808822	missense	unknown
R9430:Muc5ac	UTSW	7	141808832	missense	unknown
R9454:Muc5ac	UTSW	7	141808694	missense	unknown
R9483:Muc5ac	UTSW	7	141811728	nonsense	probably null
R9581:Muc5ac	UTSW	7	141810062	missense	unknown
R9610:Muc5ac	UTSW	7	141796341	missense	possibly damaging	0.86
R9642:Muc5ac	UTSW	7	141795864	missense	possibly damaging	0.71
R9684:Muc5ac	UTSW	7	141811061	missense	probably benign	0.41
R9760:Muc5ac	UTSW	7	141807248	missense	probably benign	0.05
R9778:Muc5ac	UTSW	7	141795284	nonsense	probably null
X0060:Muc5ac	UTSW	7	141803333	missense	possibly damaging	0.71
Z1088:Muc5ac	UTSW	7	141809744	intron	probably benign
Z1088:Muc5ac	UTSW	7	141811692	missense	possibly damaging	0.86
Z1177:Muc5ac	UTSW	7	141809224	missense	unknown
Z1177:Muc5ac	UTSW	7	141818040	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- AGGACTGACAAACCCTGGGTAC -3'
(R):5'- TGGTCCTCAGAGACCATCAC -3'

Sequencing Primer
(F):5'- GGTACCCAATTCTGCCATTTGG -3'
(R):5'- ATTTATACGTACCTCCACAGGC -3'

Posted On

2016-06-21