Incidental Mutation 'R5141:Ncan'
ID 396468
Institutional Source Beutler Lab
Gene Symbol Ncan
Ensembl Gene ENSMUSG00000002341
Gene Name neurocan
Synonyms Cspg3-rs, Tgfbit, Cspg3
MMRRC Submission 042727-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5141 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 70545735-70573494 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70565487 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 179 (E179G)
Ref Sequence ENSEMBL: ENSMUSP00000002412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002412]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000002412
AA Change: E179G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: E179G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 30 N/A INTRINSIC
IG 43 157 9.63e-6 SMART
LINK 157 254 2.22e-56 SMART
LINK 258 356 4.72e-60 SMART
low complexity region 575 586 N/A INTRINSIC
low complexity region 602 632 N/A INTRINSIC
low complexity region 663 677 N/A INTRINSIC
EGF 963 996 6.5e-5 SMART
EGF_CA 998 1034 9.77e-9 SMART
CLECT 1040 1161 1.97e-41 SMART
CCP 1167 1223 2.53e-12 SMART
low complexity region 1225 1256 N/A INTRINSIC
Meta Mutation Damage Score 0.4401 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (76/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A G 14: 68,810,577 (GRCm39) V193A probably benign Het
Adamts18 T A 8: 114,501,902 (GRCm39) T320S probably damaging Het
Adamtsl1 G T 4: 86,075,087 (GRCm39) M151I possibly damaging Het
Adgrv1 A T 13: 81,419,037 (GRCm39) V5986E probably damaging Het
Aifm3 A G 16: 17,317,586 (GRCm39) E69G probably damaging Het
Akap13 C A 7: 75,259,362 (GRCm39) T662K probably benign Het
Alms1 A G 6: 85,598,414 (GRCm39) D1080G probably benign Het
Als2 T C 1: 59,209,611 (GRCm39) E1457G possibly damaging Het
Apobec4 A G 1: 152,631,964 (GRCm39) probably benign Het
Apoo-ps C T 13: 107,550,895 (GRCm39) noncoding transcript Het
Aspscr1 G A 11: 120,580,003 (GRCm39) V181I probably benign Het
Atrn T C 2: 130,841,050 (GRCm39) probably benign Het
C3 T A 17: 57,526,570 (GRCm39) I804F probably damaging Het
Cbfa2t3 C T 8: 123,361,760 (GRCm39) G421R probably benign Het
Chmp4c A G 3: 10,432,213 (GRCm39) E41G probably damaging Het
Clk4 T A 11: 51,166,598 (GRCm39) F96L possibly damaging Het
Ctsg G A 14: 56,339,184 (GRCm39) R25* probably null Het
Cul1 A G 6: 47,497,773 (GRCm39) D618G probably benign Het
Cylc2 T C 4: 51,228,587 (GRCm39) probably benign Het
Dip2a G A 10: 76,106,287 (GRCm39) T1326I probably damaging Het
Etnk2 A G 1: 133,296,600 (GRCm39) I210V probably benign Het
Gm5773 T A 3: 93,681,034 (GRCm39) D235E probably benign Het
Gm7353 T C 7: 3,161,001 (GRCm39) noncoding transcript Het
Gpi1 G A 7: 33,926,521 (GRCm39) probably benign Het
Ing4 T C 6: 125,016,837 (GRCm39) M5T probably benign Het
Inpp4a A G 1: 37,419,168 (GRCm39) I583V probably benign Het
Isyna1 T C 8: 71,047,543 (GRCm39) V64A probably damaging Het
Katnal2 T A 18: 77,085,337 (GRCm39) D310V probably damaging Het
Kbtbd8 A G 6: 95,098,820 (GRCm39) T126A probably damaging Het
Kif13a T C 13: 46,906,197 (GRCm39) D582G probably benign Het
Lmf2 G A 15: 89,235,810 (GRCm39) probably null Het
Lrp2 T C 2: 69,382,693 (GRCm39) probably null Het
Lrp4 T C 2: 91,309,023 (GRCm39) probably benign Het
Lyzl1 A C 18: 4,169,209 (GRCm39) D71A possibly damaging Het
Mak C T 13: 41,186,039 (GRCm39) C543Y possibly damaging Het
Mapk8ip1 T C 2: 92,217,110 (GRCm39) D404G probably damaging Het
Mdga1 C T 17: 30,071,467 (GRCm39) E385K probably benign Het
Mst1r T A 9: 107,789,440 (GRCm39) I573N probably damaging Het
Muc5ac T A 7: 141,368,479 (GRCm39) N2365K possibly damaging Het
Nlgn2 C T 11: 69,716,216 (GRCm39) R775H probably damaging Het
Or10d5 T G 9: 39,861,170 (GRCm39) K299T probably benign Het
Or4c122 A C 2: 89,079,473 (GRCm39) Y176* probably null Het
Or8g20 A G 9: 39,395,827 (GRCm39) F238L probably damaging Het
Pcolce G T 5: 137,604,012 (GRCm39) Q352K probably benign Het
Peg3 G T 7: 6,712,381 (GRCm39) T947N probably benign Het
Pld3 C T 7: 27,233,220 (GRCm39) D344N probably damaging Het
Plec A C 15: 76,074,733 (GRCm39) D411E probably damaging Het
Pmp2 C T 3: 10,247,474 (GRCm39) D72N probably benign Het
Ptpn9 T C 9: 56,943,960 (GRCm39) V278A possibly damaging Het
Rbm33 A G 5: 28,557,687 (GRCm39) H300R probably damaging Het
Rpgrip1l T C 8: 91,987,546 (GRCm39) Q837R probably benign Het
Rwdd4a T C 8: 48,003,709 (GRCm39) probably benign Het
Sema6a T C 18: 47,381,455 (GRCm39) T1048A probably damaging Het
Senp1 G A 15: 97,974,488 (GRCm39) A108V probably benign Het
Serpine2 G T 1: 79,780,580 (GRCm39) Q290K possibly damaging Het
Sesn1 A G 10: 41,687,097 (GRCm39) N27S probably benign Het
Shroom1 T A 11: 53,354,809 (GRCm39) L243* probably null Het
Slc17a5 A G 9: 78,448,270 (GRCm39) Y395H probably damaging Het
Slc5a8 T C 10: 88,755,422 (GRCm39) probably null Het
Sptbn5 G A 2: 119,892,212 (GRCm39) S1083F probably benign Het
Stx4a T A 7: 127,445,787 (GRCm39) V231E probably damaging Het
Swt1 A T 1: 151,287,145 (GRCm39) S116T probably benign Het
Syt9 C T 7: 107,103,426 (GRCm39) T408I probably damaging Het
Tgm7 T C 2: 120,931,480 (GRCm39) T228A probably benign Het
Tmem115 A G 9: 107,415,141 (GRCm39) D310G probably benign Het
Trcg1 G A 9: 57,148,587 (GRCm39) G53D probably damaging Het
Tsfm T C 10: 126,865,482 (GRCm39) K100E probably damaging Het
Usp1 A G 4: 98,822,446 (GRCm39) T587A probably damaging Het
Vcpip1 G T 1: 9,818,302 (GRCm39) A27E unknown Het
Vmn2r49 T C 7: 9,720,300 (GRCm39) N397S probably benign Het
Vmn2r8 A G 5: 108,956,572 (GRCm39) S17P probably damaging Het
Vwa3b A G 1: 37,226,102 (GRCm39) probably benign Het
Ythdc2 T A 18: 44,998,114 (GRCm39) S1094T probably benign Het
Zbtb22 C G 17: 34,137,610 (GRCm39) S585C possibly damaging Het
Zhx2 A G 15: 57,685,182 (GRCm39) T184A probably benign Het
Other mutations in Ncan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ncan APN 8 70,567,921 (GRCm39) missense probably benign 0.24
IGL00924:Ncan APN 8 70,561,039 (GRCm39) missense possibly damaging 0.78
IGL01319:Ncan APN 8 70,550,212 (GRCm39) missense probably damaging 0.99
IGL01407:Ncan APN 8 70,554,607 (GRCm39) missense probably benign 0.17
IGL01528:Ncan APN 8 70,562,731 (GRCm39) missense probably benign 0.00
IGL01567:Ncan APN 8 70,560,984 (GRCm39) missense probably benign 0.09
IGL01808:Ncan APN 8 70,560,090 (GRCm39) critical splice donor site probably null
IGL02543:Ncan APN 8 70,561,221 (GRCm39) missense probably benign 0.37
IGL02551:Ncan APN 8 70,555,112 (GRCm39) missense probably damaging 1.00
IGL02899:Ncan APN 8 70,567,698 (GRCm39) missense possibly damaging 0.95
IGL02940:Ncan APN 8 70,562,735 (GRCm39) missense probably benign 0.02
IGL03058:Ncan APN 8 70,560,582 (GRCm39) missense possibly damaging 0.83
learned UTSW 8 70,550,731 (GRCm39) nonsense probably null
sagacious UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R0219:Ncan UTSW 8 70,567,984 (GRCm39) missense probably benign 0.08
R0538:Ncan UTSW 8 70,561,252 (GRCm39) missense possibly damaging 0.86
R0540:Ncan UTSW 8 70,567,809 (GRCm39) missense possibly damaging 0.93
R0854:Ncan UTSW 8 70,565,202 (GRCm39) missense probably damaging 1.00
R0918:Ncan UTSW 8 70,561,039 (GRCm39) missense possibly damaging 0.78
R1344:Ncan UTSW 8 70,560,819 (GRCm39) missense probably benign
R1575:Ncan UTSW 8 70,562,848 (GRCm39) missense probably benign 0.27
R1739:Ncan UTSW 8 70,560,736 (GRCm39) missense probably benign 0.03
R1847:Ncan UTSW 8 70,555,104 (GRCm39) missense probably damaging 0.96
R1859:Ncan UTSW 8 70,567,998 (GRCm39) missense possibly damaging 0.94
R2320:Ncan UTSW 8 70,560,868 (GRCm39) missense probably benign
R2370:Ncan UTSW 8 70,565,463 (GRCm39) missense probably benign 0.05
R3407:Ncan UTSW 8 70,564,801 (GRCm39) missense probably damaging 1.00
R3408:Ncan UTSW 8 70,564,801 (GRCm39) missense probably damaging 1.00
R3961:Ncan UTSW 8 70,562,950 (GRCm39) missense probably benign 0.05
R4155:Ncan UTSW 8 70,562,727 (GRCm39) missense possibly damaging 0.87
R4156:Ncan UTSW 8 70,562,727 (GRCm39) missense possibly damaging 0.87
R4365:Ncan UTSW 8 70,567,861 (GRCm39) missense probably damaging 1.00
R4858:Ncan UTSW 8 70,556,705 (GRCm39) missense probably benign 0.00
R4925:Ncan UTSW 8 70,562,604 (GRCm39) missense probably benign 0.02
R4942:Ncan UTSW 8 70,552,944 (GRCm39) missense probably damaging 1.00
R4976:Ncan UTSW 8 70,567,675 (GRCm39) missense probably damaging 0.98
R5119:Ncan UTSW 8 70,567,675 (GRCm39) missense probably damaging 0.98
R5679:Ncan UTSW 8 70,565,276 (GRCm39) missense probably damaging 1.00
R5706:Ncan UTSW 8 70,554,667 (GRCm39) missense probably damaging 0.99
R5915:Ncan UTSW 8 70,550,731 (GRCm39) nonsense probably null
R6033:Ncan UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R6033:Ncan UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R6223:Ncan UTSW 8 70,562,604 (GRCm39) missense probably benign 0.02
R6390:Ncan UTSW 8 70,567,899 (GRCm39) missense probably benign 0.34
R6533:Ncan UTSW 8 70,549,007 (GRCm39) missense probably benign 0.01
R6836:Ncan UTSW 8 70,552,965 (GRCm39) missense possibly damaging 0.84
R6869:Ncan UTSW 8 70,560,557 (GRCm39) missense probably benign 0.08
R7229:Ncan UTSW 8 70,552,961 (GRCm39) missense possibly damaging 0.69
R7232:Ncan UTSW 8 70,564,738 (GRCm39) missense probably damaging 1.00
R7293:Ncan UTSW 8 70,567,861 (GRCm39) missense probably damaging 0.98
R7406:Ncan UTSW 8 70,562,749 (GRCm39) missense probably benign 0.00
R7474:Ncan UTSW 8 70,554,691 (GRCm39) missense possibly damaging 0.53
R7779:Ncan UTSW 8 70,567,661 (GRCm39) missense probably damaging 0.99
R7973:Ncan UTSW 8 70,550,225 (GRCm39) missense probably benign 0.00
R8113:Ncan UTSW 8 70,561,221 (GRCm39) missense possibly damaging 0.58
R8269:Ncan UTSW 8 70,560,330 (GRCm39) missense probably benign 0.01
R8947:Ncan UTSW 8 70,555,171 (GRCm39) missense probably damaging 0.98
R9324:Ncan UTSW 8 70,560,648 (GRCm39) missense possibly damaging 0.75
R9717:Ncan UTSW 8 70,554,628 (GRCm39) missense probably damaging 1.00
R9803:Ncan UTSW 8 70,560,751 (GRCm39) missense probably benign 0.06
Z1177:Ncan UTSW 8 70,550,122 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGCCTCTTTCTCCAGGAGC -3'
(R):5'- GCCAGCCTAGGGTACATGAG -3'

Sequencing Primer
(F):5'- TTTCTCCAGGAGCGACCC -3'
(R):5'- GGACTCAGAAATTCGCTTGC -3'
Posted On 2016-06-21