Mutagenetix > Incidental Mutations

Incidental Mutation 'R5141:Adamts18'

396471

Institutional Source

Beutler Lab

Gene Symbol

Adamts18

Ensembl Gene

ENSMUSG00000053399

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 18

Synonyms

E130314N14Rik

MMRRC Submission

042727-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R5141 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

113697126-113848738 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 113775270 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 320 (T320S)

Ref Sequence

ENSEMBL: ENSMUSP00000090801 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093113] [ENSMUST00000212665]

Predicted Effect

probably damaging
Transcript: ENSMUST00000093113
AA Change: T320S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000090801
Gene: ENSMUSG00000053399
AA Change: T320S

Domain	Start	End	E-Value	Type
signal peptide	1	47	N/A	INTRINSIC
Pfam:Pep_M12B_propep	63	203	3.4e-37	PFAM
Pfam:Reprolysin_5	292	473	1.3e-14	PFAM
Pfam:Reprolysin_4	294	494	2.6e-11	PFAM
Pfam:Reprolysin	294	498	2.7e-30	PFAM
Pfam:Reprolysin_2	311	488	1.7e-14	PFAM
Pfam:Reprolysin_3	315	447	1.5e-11	PFAM
TSP1	592	644	7.37e-17	SMART
Pfam:ADAM_spacer1	749	861	1.7e-38	PFAM
TSP1	878	932	1.55e-1	SMART
TSP1	934	992	5.07e-6	SMART
TSP1	994	1049	1.65e-5	SMART
TSP1	1055	1116	1.71e-3	SMART
TSP1	1125	1171	5.27e-4	SMART
Pfam:PLAC	1186	1216	1.2e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000212437

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212527

Predicted Effect

probably benign
Transcript: ENSMUST00000212665

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213061

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213076

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213078

Meta Mutation Damage Score

0.3336

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

96% (76/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may regulate hemostatic balance and function as a tumor suppressor. Mutations in this gene may be associated with microcornea, myopic chorioretinal atrophy, and telecanthus (MMCAT) and cone-rod dystrophy in human patients. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a floxed allele exhibit some fertility defects. Mice homozygous for a null allele exhibit growth and eye defects and increased susceptibility to chemically induced tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamdec1	A	G	14: 68,573,128	V193A	probably benign	Het
Adamtsl1	G	T	4: 86,156,850	M151I	possibly damaging	Het
Adgrv1	A	T	13: 81,270,918	V5986E	probably damaging	Het
Aifm3	A	G	16: 17,499,722	E69G	probably damaging	Het
Akap13	C	A	7: 75,609,614	T662K	probably benign	Het
Alms1	A	G	6: 85,621,432	D1080G	probably benign	Het
Als2	T	C	1: 59,170,452	E1457G	possibly damaging	Het
Apobec4	A	G	1: 152,756,213		probably benign	Het
Apoo-ps	C	T	13: 107,414,395		noncoding transcript	Het
Aspscr1	G	A	11: 120,689,177	V181I	probably benign	Het
Atrn	T	C	2: 130,999,130		probably benign	Het
C3	T	A	17: 57,219,570	I804F	probably damaging	Het
Cbfa2t3	C	T	8: 122,635,021	G421R	probably benign	Het
Chmp4c	A	G	3: 10,367,153	E41G	probably damaging	Het
Clk4	T	A	11: 51,275,771	F96L	possibly damaging	Het
Ctsg	G	A	14: 56,101,727	R25*	probably null	Het
Cul1	A	G	6: 47,520,839	D618G	probably benign	Het
Cylc2	T	C	4: 51,228,587		probably benign	Het
Dip2a	G	A	10: 76,270,453	T1326I	probably damaging	Het
Etnk2	A	G	1: 133,368,862	I210V	probably benign	Het
Gm5773	T	A	3: 93,773,727	D235E	probably benign	Het
Gm7353	T	C	7: 3,111,001		noncoding transcript	Het
Gpi1	G	A	7: 34,227,096		probably benign	Het
Ing4	T	C	6: 125,039,874	M5T	probably benign	Het
Inpp4a	A	G	1: 37,380,087	I583V	probably benign	Het
Isyna1	T	C	8: 70,594,893	V64A	probably damaging	Het
Katnal2	T	A	18: 76,997,641	D310V	probably damaging	Het
Kbtbd8	A	G	6: 95,121,839	T126A	probably damaging	Het
Kif13a	T	C	13: 46,752,721	D582G	probably benign	Het
Lmf2	G	A	15: 89,351,607		probably null	Het
Lrp2	T	C	2: 69,552,349		probably null	Het
Lrp4	T	C	2: 91,478,678		probably benign	Het
Lyzl1	A	C	18: 4,169,209	D71A	possibly damaging	Het
Mak	C	T	13: 41,032,563	C543Y	possibly damaging	Het
Mapk8ip1	T	C	2: 92,386,765	D404G	probably damaging	Het
Mdga1	C	T	17: 29,852,493	E385K	probably benign	Het
Mst1r	T	A	9: 107,912,241	I573N	probably damaging	Het
Muc5ac	T	A	7: 141,814,742	N2365K	possibly damaging	Het
Ncan	T	C	8: 70,112,837	E179G	probably damaging	Het
Nlgn2	C	T	11: 69,825,390	R775H	probably damaging	Het
Olfr1228	A	C	2: 89,249,129	Y176*	probably null	Het
Olfr44	A	G	9: 39,484,531	F238L	probably damaging	Het
Olfr975	T	G	9: 39,949,874	K299T	probably benign	Het
Pcolce	G	T	5: 137,605,750	Q352K	probably benign	Het
Peg3	G	T	7: 6,709,382	T947N	probably benign	Het
Pld3	C	T	7: 27,533,795	D344N	probably damaging	Het
Plec	A	C	15: 76,190,533	D411E	probably damaging	Het
Pmp2	C	T	3: 10,182,414	D72N	probably benign	Het
Ptpn9	T	C	9: 57,036,676	V278A	possibly damaging	Het
Rbm33	A	G	5: 28,352,689	H300R	probably damaging	Het
Rpgrip1l	T	C	8: 91,260,918	Q837R	probably benign	Het
Rwdd4a	T	C	8: 47,550,674		probably benign	Het
Sema6a	T	C	18: 47,248,388	T1048A	probably damaging	Het
Senp1	G	A	15: 98,076,607	A108V	probably benign	Het
Serpine2	G	T	1: 79,802,863	Q290K	possibly damaging	Het
Sesn1	A	G	10: 41,811,101	N27S	probably benign	Het
Shroom1	T	A	11: 53,463,982	L243*	probably null	Het
Slc17a5	A	G	9: 78,540,988	Y395H	probably damaging	Het
Slc5a8	T	C	10: 88,919,560		probably null	Het
Sptbn5	G	A	2: 120,061,731	S1083F	probably benign	Het
Stx4a	T	A	7: 127,846,615	V231E	probably damaging	Het
Swt1	A	T	1: 151,411,394	S116T	probably benign	Het
Syt9	C	T	7: 107,504,219	T408I	probably damaging	Het
Tgm7	T	C	2: 121,100,999	T228A	probably benign	Het
Tmem115	A	G	9: 107,537,942	D310G	probably benign	Het
Trcg1	G	A	9: 57,241,304	G53D	probably damaging	Het
Tsfm	T	C	10: 127,029,613	K100E	probably damaging	Het
Usp1	A	G	4: 98,934,209	T587A	probably damaging	Het
Vcpip1	G	T	1: 9,748,077	A27E	unknown	Het
Vmn2r49	T	C	7: 9,986,373	N397S	probably benign	Het
Vmn2r8	A	G	5: 108,808,706	S17P	probably damaging	Het
Vwa3b	A	G	1: 37,187,021		probably benign	Het
Ythdc2	T	A	18: 44,865,047	S1094T	probably benign	Het
Zbtb22	C	G	17: 33,918,636	S585C	possibly damaging	Het
Zhx2	A	G	15: 57,821,786	T184A	probably benign	Het

Other mutations in Adamts18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01290:Adamts18	APN	8	113774943	missense	probably damaging	1.00
IGL01548:Adamts18	APN	8	113764299	missense	probably damaging	1.00
IGL01556:Adamts18	APN	8	113845109	missense	probably benign	0.01
IGL01833:Adamts18	APN	8	113743096	missense	probably benign	0.10
IGL02187:Adamts18	APN	8	113713194	missense	possibly damaging	0.93
IGL02551:Adamts18	APN	8	113699072	missense	probably damaging	1.00
IGL02756:Adamts18	APN	8	113714344	splice site	probably benign
IGL03188:Adamts18	APN	8	113699024	missense	probably damaging	1.00
IGL03411:Adamts18	APN	8	113764297	nonsense	probably null
R0119:Adamts18	UTSW	8	113774953	missense	possibly damaging	0.94
R0378:Adamts18	UTSW	8	113743117	missense	probably damaging	1.00
R0410:Adamts18	UTSW	8	113714358	nonsense	probably null
R0480:Adamts18	UTSW	8	113738818	missense	possibly damaging	0.93
R0514:Adamts18	UTSW	8	113738769	splice site	probably null
R0924:Adamts18	UTSW	8	113705396	splice site	probably null
R0930:Adamts18	UTSW	8	113705396	splice site	probably null
R1333:Adamts18	UTSW	8	113705173	splice site	probably benign
R1441:Adamts18	UTSW	8	113754562	critical splice donor site	probably null
R2082:Adamts18	UTSW	8	113775333	missense	probably damaging	1.00
R2146:Adamts18	UTSW	8	113845003	missense	possibly damaging	0.58
R2371:Adamts18	UTSW	8	113705261	missense	probably benign	0.36
R3148:Adamts18	UTSW	8	113738858	missense	probably damaging	1.00
R3963:Adamts18	UTSW	8	113777811	missense	probably benign	0.00
R4056:Adamts18	UTSW	8	113737580	nonsense	probably null
R4486:Adamts18	UTSW	8	113713193	missense	probably benign	0.00
R4608:Adamts18	UTSW	8	113737613	missense	probably damaging	1.00
R4624:Adamts18	UTSW	8	113773168	nonsense	probably null
R4626:Adamts18	UTSW	8	113773168	nonsense	probably null
R4627:Adamts18	UTSW	8	113773168	nonsense	probably null
R4628:Adamts18	UTSW	8	113773168	nonsense	probably null
R4629:Adamts18	UTSW	8	113773168	nonsense	probably null
R4710:Adamts18	UTSW	8	113706926	missense	probably damaging	0.98
R4959:Adamts18	UTSW	8	113736725	nonsense	probably null
R4973:Adamts18	UTSW	8	113736725	nonsense	probably null
R4976:Adamts18	UTSW	8	113699010	missense	probably benign	0.31
R5119:Adamts18	UTSW	8	113699010	missense	probably benign	0.31
R5422:Adamts18	UTSW	8	113698974	missense	probably benign	0.06
R5587:Adamts18	UTSW	8	113775360	nonsense	probably null
R5868:Adamts18	UTSW	8	113777748	missense	possibly damaging	0.69
R5893:Adamts18	UTSW	8	113773077	missense	probably damaging	1.00
R5906:Adamts18	UTSW	8	113709619	missense	probably benign	0.00
R5942:Adamts18	UTSW	8	113777748	missense	probably benign	0.01
R6006:Adamts18	UTSW	8	113706974	missense	probably damaging	1.00
R6608:Adamts18	UTSW	8	113775279	missense	probably damaging	1.00
R6725:Adamts18	UTSW	8	113743201	missense	probably damaging	1.00
R7002:Adamts18	UTSW	8	113775290	missense	possibly damaging	0.69
R7276:Adamts18	UTSW	8	113775264	missense	probably damaging	0.99
R7292:Adamts18	UTSW	8	113709645	missense	probably benign	0.00
R7411:Adamts18	UTSW	8	113777730	missense	probably damaging	0.99
R7685:Adamts18	UTSW	8	113713223	missense	probably damaging	1.00
R7737:Adamts18	UTSW	8	113736934	splice site	probably null
R7860:Adamts18	UTSW	8	113775276	missense	probably damaging	1.00
R7936:Adamts18	UTSW	8	113767128	missense	probably damaging	1.00
R8197:Adamts18	UTSW	8	113754595	missense	probably damaging	1.00
R8363:Adamts18	UTSW	8	113767163	missense	probably damaging	1.00
Z1088:Adamts18	UTSW	8	113775440	missense	possibly damaging	0.86
Z1176:Adamts18	UTSW	8	113743168	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- ATGGGTGTAGGTTTCAATCTTACCAG -3'
(R):5'- TCTCAGCCTATGTCACCCAG -3'

Sequencing Primer
(F):5'- GGTTTCAATCTTACCAGACTCAAAAG -3'
(R):5'- AGCCTATGTCACCCAGATTTTG -3'

Posted On

2016-06-21