Incidental Mutation 'R5141:Cbfa2t3'
ID 396472
Institutional Source Beutler Lab
Gene Symbol Cbfa2t3
Ensembl Gene ENSMUSG00000006362
Gene Name core-binding factor, runt domain, alpha subunit 2, translocated to, 3 (human)
Synonyms MTGR2, ETO-2, Eto2, A630044F12Rik
MMRRC Submission 042727-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5141 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 122625141-122699109 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 122635021 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 421 (G421R)
Ref Sequence ENSEMBL: ENSMUSP00000118997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006525] [ENSMUST00000064674] [ENSMUST00000127664] [ENSMUST00000127984] [ENSMUST00000134045]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000006525
AA Change: G360R

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000006525
Gene: ENSMUSG00000006362
AA Change: G360R

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
TAFH 87 177 5.46e-52 SMART
low complexity region 248 257 N/A INTRINSIC
Pfam:NHR2 295 361 3.6e-41 PFAM
PDB:2KYG|C 395 424 3e-10 PDB
Pfam:zf-MYND 472 508 2.6e-10 PFAM
low complexity region 529 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064674
AA Change: G386R

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000065728
Gene: ENSMUSG00000006362
AA Change: G386R

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
TAFH 113 203 5.46e-52 SMART
low complexity region 274 283 N/A INTRINSIC
Pfam:NHR2 321 387 7.1e-41 PFAM
PDB:2KYG|C 421 450 1e-10 PDB
Pfam:zf-MYND 498 534 7.1e-10 PFAM
low complexity region 555 578 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127984
AA Change: G421R

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118997
Gene: ENSMUSG00000006362
AA Change: G421R

DomainStartEndE-ValueType
low complexity region 47 62 N/A INTRINSIC
TAFH 148 238 5.46e-52 SMART
low complexity region 309 318 N/A INTRINSIC
Pfam:NHR2 356 422 2.3e-38 PFAM
PDB:2KYG|C 456 485 2e-10 PDB
Pfam:zf-MYND 533 569 6.9e-10 PFAM
low complexity region 590 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134045
SMART Domains Protein: ENSMUSP00000117630
Gene: ENSMUSG00000006362

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:TAFH 111 185 3.7e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142535
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (76/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myeloid translocation gene family which interact with DNA-bound transcription factors and recruit a range of corepressors to facilitate transcriptional repression. The t(16;21)(q24;q22) translocation is one of the less common karyotypic abnormalities in acute myeloid leukemia. The translocation produces a chimeric gene made up of the 5'-region of the runt-related transcription factor 1 gene fused to the 3'-region of this gene. This gene is also a putative breast tumor suppressor. Alternative splicing results in transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice that are homozygote null for this gene display skewing of the early myeloid progenitor cells toward the granulocytic/macrophage lineage while reducing the numbers of megakaryocyte-erythroid progenitor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A G 14: 68,573,128 V193A probably benign Het
Adamts18 T A 8: 113,775,270 T320S probably damaging Het
Adamtsl1 G T 4: 86,156,850 M151I possibly damaging Het
Adgrv1 A T 13: 81,270,918 V5986E probably damaging Het
Aifm3 A G 16: 17,499,722 E69G probably damaging Het
Akap13 C A 7: 75,609,614 T662K probably benign Het
Alms1 A G 6: 85,621,432 D1080G probably benign Het
Als2 T C 1: 59,170,452 E1457G possibly damaging Het
Apobec4 A G 1: 152,756,213 probably benign Het
Apoo-ps C T 13: 107,414,395 noncoding transcript Het
Aspscr1 G A 11: 120,689,177 V181I probably benign Het
Atrn T C 2: 130,999,130 probably benign Het
C3 T A 17: 57,219,570 I804F probably damaging Het
Chmp4c A G 3: 10,367,153 E41G probably damaging Het
Clk4 T A 11: 51,275,771 F96L possibly damaging Het
Ctsg G A 14: 56,101,727 R25* probably null Het
Cul1 A G 6: 47,520,839 D618G probably benign Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dip2a G A 10: 76,270,453 T1326I probably damaging Het
Etnk2 A G 1: 133,368,862 I210V probably benign Het
Gm5773 T A 3: 93,773,727 D235E probably benign Het
Gm7353 T C 7: 3,111,001 noncoding transcript Het
Gpi1 G A 7: 34,227,096 probably benign Het
Ing4 T C 6: 125,039,874 M5T probably benign Het
Inpp4a A G 1: 37,380,087 I583V probably benign Het
Isyna1 T C 8: 70,594,893 V64A probably damaging Het
Katnal2 T A 18: 76,997,641 D310V probably damaging Het
Kbtbd8 A G 6: 95,121,839 T126A probably damaging Het
Kif13a T C 13: 46,752,721 D582G probably benign Het
Lmf2 G A 15: 89,351,607 probably null Het
Lrp2 T C 2: 69,552,349 probably null Het
Lrp4 T C 2: 91,478,678 probably benign Het
Lyzl1 A C 18: 4,169,209 D71A possibly damaging Het
Mak C T 13: 41,032,563 C543Y possibly damaging Het
Mapk8ip1 T C 2: 92,386,765 D404G probably damaging Het
Mdga1 C T 17: 29,852,493 E385K probably benign Het
Mst1r T A 9: 107,912,241 I573N probably damaging Het
Muc5ac T A 7: 141,814,742 N2365K possibly damaging Het
Ncan T C 8: 70,112,837 E179G probably damaging Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1228 A C 2: 89,249,129 Y176* probably null Het
Olfr44 A G 9: 39,484,531 F238L probably damaging Het
Olfr975 T G 9: 39,949,874 K299T probably benign Het
Pcolce G T 5: 137,605,750 Q352K probably benign Het
Peg3 G T 7: 6,709,382 T947N probably benign Het
Pld3 C T 7: 27,533,795 D344N probably damaging Het
Plec A C 15: 76,190,533 D411E probably damaging Het
Pmp2 C T 3: 10,182,414 D72N probably benign Het
Ptpn9 T C 9: 57,036,676 V278A possibly damaging Het
Rbm33 A G 5: 28,352,689 H300R probably damaging Het
Rpgrip1l T C 8: 91,260,918 Q837R probably benign Het
Rwdd4a T C 8: 47,550,674 probably benign Het
Sema6a T C 18: 47,248,388 T1048A probably damaging Het
Senp1 G A 15: 98,076,607 A108V probably benign Het
Serpine2 G T 1: 79,802,863 Q290K possibly damaging Het
Sesn1 A G 10: 41,811,101 N27S probably benign Het
Shroom1 T A 11: 53,463,982 L243* probably null Het
Slc17a5 A G 9: 78,540,988 Y395H probably damaging Het
Slc5a8 T C 10: 88,919,560 probably null Het
Sptbn5 G A 2: 120,061,731 S1083F probably benign Het
Stx4a T A 7: 127,846,615 V231E probably damaging Het
Swt1 A T 1: 151,411,394 S116T probably benign Het
Syt9 C T 7: 107,504,219 T408I probably damaging Het
Tgm7 T C 2: 121,100,999 T228A probably benign Het
Tmem115 A G 9: 107,537,942 D310G probably benign Het
Trcg1 G A 9: 57,241,304 G53D probably damaging Het
Tsfm T C 10: 127,029,613 K100E probably damaging Het
Usp1 A G 4: 98,934,209 T587A probably damaging Het
Vcpip1 G T 1: 9,748,077 A27E unknown Het
Vmn2r49 T C 7: 9,986,373 N397S probably benign Het
Vmn2r8 A G 5: 108,808,706 S17P probably damaging Het
Vwa3b A G 1: 37,187,021 probably benign Het
Ythdc2 T A 18: 44,865,047 S1094T probably benign Het
Zbtb22 C G 17: 33,918,636 S585C possibly damaging Het
Zhx2 A G 15: 57,821,786 T184A probably benign Het
Other mutations in Cbfa2t3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02095:Cbfa2t3 APN 8 122633493 missense probably damaging 1.00
IGL02578:Cbfa2t3 APN 8 122633448 missense possibly damaging 0.83
IGL02934:Cbfa2t3 APN 8 122647758 missense probably benign 0.03
IGL03089:Cbfa2t3 APN 8 122635134 missense probably damaging 1.00
R0196:Cbfa2t3 UTSW 8 122633337 missense possibly damaging 0.77
R0365:Cbfa2t3 UTSW 8 122635060 missense probably benign 0.23
R0395:Cbfa2t3 UTSW 8 122638951 missense probably benign 0.09
R0784:Cbfa2t3 UTSW 8 122650487 splice site probably benign
R0835:Cbfa2t3 UTSW 8 122647778 missense probably benign 0.00
R1608:Cbfa2t3 UTSW 8 122647709 missense probably damaging 0.99
R2008:Cbfa2t3 UTSW 8 122643293 missense probably damaging 0.99
R2088:Cbfa2t3 UTSW 8 122637986 unclassified probably benign
R2095:Cbfa2t3 UTSW 8 122634988 missense probably benign
R4079:Cbfa2t3 UTSW 8 122647695 splice site probably null
R4175:Cbfa2t3 UTSW 8 122643318 missense probably damaging 1.00
R5013:Cbfa2t3 UTSW 8 122638859 missense possibly damaging 0.95
R5391:Cbfa2t3 UTSW 8 122633395 nonsense probably null
R6067:Cbfa2t3 UTSW 8 122643497 missense probably benign 0.00
R6078:Cbfa2t3 UTSW 8 122643497 missense probably benign 0.00
R6192:Cbfa2t3 UTSW 8 122634396 missense probably benign 0.00
R6281:Cbfa2t3 UTSW 8 122633409 missense probably damaging 1.00
R6520:Cbfa2t3 UTSW 8 122635801 missense probably benign 0.02
R6936:Cbfa2t3 UTSW 8 122647739 missense probably damaging 0.97
R7154:Cbfa2t3 UTSW 8 122638144 nonsense probably null
R7196:Cbfa2t3 UTSW 8 122638990 missense probably benign 0.26
R7295:Cbfa2t3 UTSW 8 122638029 missense probably benign 0.02
R7514:Cbfa2t3 UTSW 8 122635126 missense probably damaging 1.00
R7616:Cbfa2t3 UTSW 8 122633337 missense possibly damaging 0.87
R8070:Cbfa2t3 UTSW 8 122642981 missense possibly damaging 0.81
R8485:Cbfa2t3 UTSW 8 122630778 missense probably damaging 0.97
R8534:Cbfa2t3 UTSW 8 122638914 missense probably damaging 1.00
R9718:Cbfa2t3 UTSW 8 122638197 missense probably benign 0.25
U15987:Cbfa2t3 UTSW 8 122643497 missense probably benign 0.00
Z1176:Cbfa2t3 UTSW 8 122698895 start gained probably benign
Z1177:Cbfa2t3 UTSW 8 122630757 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCGAGTGTTGGCTAGCTTTC -3'
(R):5'- TATAGATTTCTGTGCCCCGC -3'

Sequencing Primer
(F):5'- CTGGAGAATTAGTGGCATCCTAC -3'
(R):5'- CCTTCAGGGACGTTGAGCTG -3'
Posted On 2016-06-21