Incidental Mutation 'R5141:Sesn1'
ID396479
Institutional Source Beutler Lab
Gene Symbol Sesn1
Ensembl Gene ENSMUSG00000038332
Gene Namesestrin 1
SynonymsSEST1, 1110002G11Rik, PA26
MMRRC Submission 042727-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5141 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location41809935-41908424 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41811101 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 27 (N27S)
Ref Sequence ENSEMBL: ENSMUSP00000097515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019951] [ENSMUST00000099931] [ENSMUST00000186239] [ENSMUST00000187143] [ENSMUST00000189770] [ENSMUST00000190022] [ENSMUST00000191498]
Predicted Effect probably benign
Transcript: ENSMUST00000019951
SMART Domains Protein: ENSMUSP00000019951
Gene: ENSMUSG00000019813

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 227 1.2e-64 PFAM
low complexity region 234 245 N/A INTRINSIC
Pfam:Cep57_MT_bd 283 356 2.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099931
AA Change: N27S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097515
Gene: ENSMUSG00000038332
AA Change: N27S

DomainStartEndE-ValueType
Pfam:PA26 106 550 1.2e-212 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186239
SMART Domains Protein: ENSMUSP00000139509
Gene: ENSMUSG00000019813

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 227 2.3e-72 PFAM
low complexity region 234 245 N/A INTRINSIC
Pfam:Cep57_MT_bd 281 356 1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187143
SMART Domains Protein: ENSMUSP00000140389
Gene: ENSMUSG00000019813

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 223 1.1e-66 PFAM
Pfam:Cep57_MT_bd 252 327 6.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189222
Predicted Effect probably benign
Transcript: ENSMUST00000189770
SMART Domains Protein: ENSMUSP00000140147
Gene: ENSMUSG00000019813

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 223 1.1e-66 PFAM
Pfam:Cep57_MT_bd 252 327 6.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190022
SMART Domains Protein: ENSMUSP00000141031
Gene: ENSMUSG00000019813

DomainStartEndE-ValueType
Pfam:Cep57_CLD 45 151 6.6e-38 PFAM
low complexity region 158 169 N/A INTRINSIC
Pfam:Cep57_MT_bd 205 280 1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191498
SMART Domains Protein: ENSMUSP00000141089
Gene: ENSMUSG00000019813

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 229 1.9e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215496
Meta Mutation Damage Score 0.0637 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (76/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sestrin family. Sestrins are induced by the p53 tumor suppressor protein and play a role in the cellular response to DNA damage and oxidative stress. The encoded protein mediates p53 inhibition of cell growth by activating AMP-activated protein kinase, which results in the inhibition of the mammalian target of rapamycin protein. The encoded protein also plays a critical role in antioxidant defense by regenerating overoxidized peroxiredoxins, and the expression of this gene is a potential marker for exposure to radiation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a kncok-out allele exhibit enhanced responsiveness to an influenza vaccine in aged mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A G 14: 68,573,128 V193A probably benign Het
Adamts18 T A 8: 113,775,270 T320S probably damaging Het
Adamtsl1 G T 4: 86,156,850 M151I possibly damaging Het
Adgrv1 A T 13: 81,270,918 V5986E probably damaging Het
Aifm3 A G 16: 17,499,722 E69G probably damaging Het
Akap13 C A 7: 75,609,614 T662K probably benign Het
Alms1 A G 6: 85,621,432 D1080G probably benign Het
Als2 T C 1: 59,170,452 E1457G possibly damaging Het
Apobec4 A G 1: 152,756,213 probably benign Het
Apoo-ps C T 13: 107,414,395 noncoding transcript Het
Aspscr1 G A 11: 120,689,177 V181I probably benign Het
Atrn T C 2: 130,999,130 probably benign Het
C3 T A 17: 57,219,570 I804F probably damaging Het
Cbfa2t3 C T 8: 122,635,021 G421R probably benign Het
Chmp4c A G 3: 10,367,153 E41G probably damaging Het
Clk4 T A 11: 51,275,771 F96L possibly damaging Het
Ctsg G A 14: 56,101,727 R25* probably null Het
Cul1 A G 6: 47,520,839 D618G probably benign Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dip2a G A 10: 76,270,453 T1326I probably damaging Het
Etnk2 A G 1: 133,368,862 I210V probably benign Het
Gm5773 T A 3: 93,773,727 D235E probably benign Het
Gm7353 T C 7: 3,111,001 noncoding transcript Het
Gpi1 G A 7: 34,227,096 probably benign Het
Ing4 T C 6: 125,039,874 M5T probably benign Het
Inpp4a A G 1: 37,380,087 I583V probably benign Het
Isyna1 T C 8: 70,594,893 V64A probably damaging Het
Katnal2 T A 18: 76,997,641 D310V probably damaging Het
Kbtbd8 A G 6: 95,121,839 T126A probably damaging Het
Kif13a T C 13: 46,752,721 D582G probably benign Het
Lmf2 G A 15: 89,351,607 probably null Het
Lrp2 T C 2: 69,552,349 probably null Het
Lrp4 T C 2: 91,478,678 probably benign Het
Lyzl1 A C 18: 4,169,209 D71A possibly damaging Het
Mak C T 13: 41,032,563 C543Y possibly damaging Het
Mapk8ip1 T C 2: 92,386,765 D404G probably damaging Het
Mdga1 C T 17: 29,852,493 E385K probably benign Het
Mst1r T A 9: 107,912,241 I573N probably damaging Het
Muc5ac T A 7: 141,814,742 N2365K possibly damaging Het
Ncan T C 8: 70,112,837 E179G probably damaging Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1228 A C 2: 89,249,129 Y176* probably null Het
Olfr44 A G 9: 39,484,531 F238L probably damaging Het
Olfr975 T G 9: 39,949,874 K299T probably benign Het
Pcolce G T 5: 137,605,750 Q352K probably benign Het
Peg3 G T 7: 6,709,382 T947N probably benign Het
Pld3 C T 7: 27,533,795 D344N probably damaging Het
Plec A C 15: 76,190,533 D411E probably damaging Het
Pmp2 C T 3: 10,182,414 D72N probably benign Het
Ptpn9 T C 9: 57,036,676 V278A possibly damaging Het
Rbm33 A G 5: 28,352,689 H300R probably damaging Het
Rpgrip1l T C 8: 91,260,918 Q837R probably benign Het
Rwdd4a T C 8: 47,550,674 probably benign Het
Sema6a T C 18: 47,248,388 T1048A probably damaging Het
Senp1 G A 15: 98,076,607 A108V probably benign Het
Serpine2 G T 1: 79,802,863 Q290K possibly damaging Het
Shroom1 T A 11: 53,463,982 L243* probably null Het
Slc17a5 A G 9: 78,540,988 Y395H probably damaging Het
Slc5a8 T C 10: 88,919,560 probably null Het
Sptbn5 G A 2: 120,061,731 S1083F probably benign Het
Stx4a T A 7: 127,846,615 V231E probably damaging Het
Swt1 A T 1: 151,411,394 S116T probably benign Het
Syt9 C T 7: 107,504,219 T408I probably damaging Het
Tgm7 T C 2: 121,100,999 T228A probably benign Het
Tmem115 A G 9: 107,537,942 D310G probably benign Het
Trcg1 G A 9: 57,241,304 G53D probably damaging Het
Tsfm T C 10: 127,029,613 K100E probably damaging Het
Usp1 A G 4: 98,934,209 T587A probably damaging Het
Vcpip1 G T 1: 9,748,077 A27E unknown Het
Vmn2r49 T C 7: 9,986,373 N397S probably benign Het
Vmn2r8 A G 5: 108,808,706 S17P probably damaging Het
Vwa3b A G 1: 37,187,021 probably benign Het
Ythdc2 T A 18: 44,865,047 S1094T probably benign Het
Zbtb22 C G 17: 33,918,636 S585C possibly damaging Het
Zhx2 A G 15: 57,821,786 T184A probably benign Het
Other mutations in Sesn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Sesn1 APN 10 41898325 missense probably damaging 1.00
IGL01766:Sesn1 APN 10 41898369 missense probably benign 0.00
R1103:Sesn1 UTSW 10 41902593 missense possibly damaging 0.94
R1557:Sesn1 UTSW 10 41903766 missense probably damaging 1.00
R1587:Sesn1 UTSW 10 41811112 missense probably benign
R2177:Sesn1 UTSW 10 41903782 missense possibly damaging 0.73
R2437:Sesn1 UTSW 10 41905319 missense probably damaging 1.00
R3915:Sesn1 UTSW 10 41894890 missense probably benign 0.13
R4965:Sesn1 UTSW 10 41895009 missense probably damaging 1.00
R5257:Sesn1 UTSW 10 41894988 missense probably benign 0.03
R5258:Sesn1 UTSW 10 41894988 missense probably benign 0.03
R5639:Sesn1 UTSW 10 41811271 missense probably benign
R5899:Sesn1 UTSW 10 41811193 missense probably benign
R6024:Sesn1 UTSW 10 41896200 missense probably damaging 0.99
R6310:Sesn1 UTSW 10 41896078 missense probably damaging 1.00
R7181:Sesn1 UTSW 10 41903728 missense possibly damaging 0.84
R7770:Sesn1 UTSW 10 41894058 missense probably damaging 1.00
R7909:Sesn1 UTSW 10 41811116 missense probably benign 0.03
R7990:Sesn1 UTSW 10 41811116 missense probably benign 0.03
R7996:Sesn1 UTSW 10 41894933
Predicted Primers PCR Primer
(F):5'- TTCACGACGGCTGGATTTCTC -3'
(R):5'- CTCTCTCGCACATCTTTAAAGGG -3'

Sequencing Primer
(F):5'- ACGGCTGGATTTCTCTGACTTTATTC -3'
(R):5'- TCTCGCACATCTTTAAAGGGACATC -3'
Posted On2016-06-21