Incidental Mutation 'R5141:Dip2a'
ID396480
Institutional Source Beutler Lab
Gene Symbol Dip2a
Ensembl Gene ENSMUSG00000020231
Gene Namedisco interacting protein 2 homolog A
SynonymsKiaa0184-hp, 4931420H10Rik, Dip2
MMRRC Submission 042727-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5141 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location76259429-76345291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 76270453 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1326 (T1326I)
Ref Sequence ENSEMBL: ENSMUSP00000101057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036033] [ENSMUST00000105417] [ENSMUST00000160048] [ENSMUST00000162524]
Predicted Effect probably damaging
Transcript: ENSMUST00000036033
AA Change: T1316I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000043710
Gene: ENSMUSG00000020231
AA Change: T1316I

DomainStartEndE-ValueType
DMAP_binding 9 122 2.55e-35 SMART
low complexity region 173 208 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
Pfam:AMP-binding 330 806 4.3e-26 PFAM
Pfam:AMP-binding 982 1456 1.4e-52 PFAM
low complexity region 1487 1498 N/A INTRINSIC
low complexity region 1511 1532 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105417
AA Change: T1326I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101057
Gene: ENSMUSG00000020231
AA Change: T1326I

DomainStartEndE-ValueType
DMAP_binding 9 122 2.55e-35 SMART
low complexity region 173 208 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
Pfam:AMP-binding 330 806 6.6e-28 PFAM
Pfam:AMP-binding 992 1466 7.3e-65 PFAM
low complexity region 1497 1508 N/A INTRINSIC
low complexity region 1521 1542 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159807
Predicted Effect probably damaging
Transcript: ENSMUST00000160048
AA Change: T1277I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125184
Gene: ENSMUSG00000020231
AA Change: T1277I

DomainStartEndE-ValueType
DMAP_binding 9 83 7.94e-23 SMART
low complexity region 134 169 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
Pfam:AMP-binding 291 767 5.3e-26 PFAM
Pfam:AMP-binding 943 1417 1.7e-52 PFAM
low complexity region 1448 1459 N/A INTRINSIC
low complexity region 1472 1493 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162524
SMART Domains Protein: ENSMUSP00000125614
Gene: ENSMUSG00000020231

DomainStartEndE-ValueType
SCOP:d1lci__ 1 77 9e-5 SMART
Meta Mutation Damage Score 0.5827 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (76/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may be involved in axon patterning in the central nervous system. This gene is not highly expressed. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A G 14: 68,573,128 V193A probably benign Het
Adamts18 T A 8: 113,775,270 T320S probably damaging Het
Adamtsl1 G T 4: 86,156,850 M151I possibly damaging Het
Adgrv1 A T 13: 81,270,918 V5986E probably damaging Het
Aifm3 A G 16: 17,499,722 E69G probably damaging Het
Akap13 C A 7: 75,609,614 T662K probably benign Het
Alms1 A G 6: 85,621,432 D1080G probably benign Het
Als2 T C 1: 59,170,452 E1457G possibly damaging Het
Apobec4 A G 1: 152,756,213 probably benign Het
Apoo-ps C T 13: 107,414,395 noncoding transcript Het
Aspscr1 G A 11: 120,689,177 V181I probably benign Het
Atrn T C 2: 130,999,130 probably benign Het
C3 T A 17: 57,219,570 I804F probably damaging Het
Cbfa2t3 C T 8: 122,635,021 G421R probably benign Het
Chmp4c A G 3: 10,367,153 E41G probably damaging Het
Clk4 T A 11: 51,275,771 F96L possibly damaging Het
Ctsg G A 14: 56,101,727 R25* probably null Het
Cul1 A G 6: 47,520,839 D618G probably benign Het
Cylc2 T C 4: 51,228,587 probably benign Het
Etnk2 A G 1: 133,368,862 I210V probably benign Het
Gm5773 T A 3: 93,773,727 D235E probably benign Het
Gm7353 T C 7: 3,111,001 noncoding transcript Het
Gpi1 G A 7: 34,227,096 probably benign Het
Ing4 T C 6: 125,039,874 M5T probably benign Het
Inpp4a A G 1: 37,380,087 I583V probably benign Het
Isyna1 T C 8: 70,594,893 V64A probably damaging Het
Katnal2 T A 18: 76,997,641 D310V probably damaging Het
Kbtbd8 A G 6: 95,121,839 T126A probably damaging Het
Kif13a T C 13: 46,752,721 D582G probably benign Het
Lmf2 G A 15: 89,351,607 probably null Het
Lrp2 T C 2: 69,552,349 probably null Het
Lrp4 T C 2: 91,478,678 probably benign Het
Lyzl1 A C 18: 4,169,209 D71A possibly damaging Het
Mak C T 13: 41,032,563 C543Y possibly damaging Het
Mapk8ip1 T C 2: 92,386,765 D404G probably damaging Het
Mdga1 C T 17: 29,852,493 E385K probably benign Het
Mst1r T A 9: 107,912,241 I573N probably damaging Het
Muc5ac T A 7: 141,814,742 N2365K possibly damaging Het
Ncan T C 8: 70,112,837 E179G probably damaging Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1228 A C 2: 89,249,129 Y176* probably null Het
Olfr44 A G 9: 39,484,531 F238L probably damaging Het
Olfr975 T G 9: 39,949,874 K299T probably benign Het
Pcolce G T 5: 137,605,750 Q352K probably benign Het
Peg3 G T 7: 6,709,382 T947N probably benign Het
Pld3 C T 7: 27,533,795 D344N probably damaging Het
Plec A C 15: 76,190,533 D411E probably damaging Het
Pmp2 C T 3: 10,182,414 D72N probably benign Het
Ptpn9 T C 9: 57,036,676 V278A possibly damaging Het
Rbm33 A G 5: 28,352,689 H300R probably damaging Het
Rpgrip1l T C 8: 91,260,918 Q837R probably benign Het
Rwdd4a T C 8: 47,550,674 probably benign Het
Sema6a T C 18: 47,248,388 T1048A probably damaging Het
Senp1 G A 15: 98,076,607 A108V probably benign Het
Serpine2 G T 1: 79,802,863 Q290K possibly damaging Het
Sesn1 A G 10: 41,811,101 N27S probably benign Het
Shroom1 T A 11: 53,463,982 L243* probably null Het
Slc17a5 A G 9: 78,540,988 Y395H probably damaging Het
Slc5a8 T C 10: 88,919,560 probably null Het
Sptbn5 G A 2: 120,061,731 S1083F probably benign Het
Stx4a T A 7: 127,846,615 V231E probably damaging Het
Swt1 A T 1: 151,411,394 S116T probably benign Het
Syt9 C T 7: 107,504,219 T408I probably damaging Het
Tgm7 T C 2: 121,100,999 T228A probably benign Het
Tmem115 A G 9: 107,537,942 D310G probably benign Het
Trcg1 G A 9: 57,241,304 G53D probably damaging Het
Tsfm T C 10: 127,029,613 K100E probably damaging Het
Usp1 A G 4: 98,934,209 T587A probably damaging Het
Vcpip1 G T 1: 9,748,077 A27E unknown Het
Vmn2r49 T C 7: 9,986,373 N397S probably benign Het
Vmn2r8 A G 5: 108,808,706 S17P probably damaging Het
Vwa3b A G 1: 37,187,021 probably benign Het
Ythdc2 T A 18: 44,865,047 S1094T probably benign Het
Zbtb22 C G 17: 33,918,636 S585C possibly damaging Het
Zhx2 A G 15: 57,821,786 T184A probably benign Het
Other mutations in Dip2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Dip2a APN 10 76313236 missense probably benign
IGL00849:Dip2a APN 10 76292318 missense probably damaging 0.99
IGL01685:Dip2a APN 10 76327749 missense probably damaging 1.00
IGL01825:Dip2a APN 10 76272680 nonsense probably null
IGL02343:Dip2a APN 10 76319478 missense probably benign 0.00
IGL02437:Dip2a APN 10 76298267 missense probably benign 0.09
IGL02981:Dip2a APN 10 76276421 missense possibly damaging 0.84
IGL03122:Dip2a APN 10 76275046 missense probably benign 0.00
IGL03261:Dip2a APN 10 76305148 missense possibly damaging 0.80
R0369:Dip2a UTSW 10 76298787 missense probably damaging 1.00
R0522:Dip2a UTSW 10 76321531 missense probably benign 0.03
R0962:Dip2a UTSW 10 76292432 unclassified probably benign
R1164:Dip2a UTSW 10 76276397 missense possibly damaging 0.72
R1309:Dip2a UTSW 10 76279776 missense probably damaging 1.00
R1426:Dip2a UTSW 10 76279820 unclassified probably benign
R1636:Dip2a UTSW 10 76321578 missense probably benign 0.01
R1823:Dip2a UTSW 10 76278502 nonsense probably null
R1830:Dip2a UTSW 10 76317963 missense probably damaging 1.00
R1876:Dip2a UTSW 10 76318091 missense probably damaging 1.00
R2284:Dip2a UTSW 10 76313193 missense probably benign 0.01
R2369:Dip2a UTSW 10 76313196 missense probably benign
R4050:Dip2a UTSW 10 76278607 missense probably damaging 1.00
R4089:Dip2a UTSW 10 76278489 splice site probably null
R4231:Dip2a UTSW 10 76319470 missense probably damaging 1.00
R4715:Dip2a UTSW 10 76296406 missense probably benign 0.34
R4752:Dip2a UTSW 10 76276657 missense probably damaging 1.00
R4846:Dip2a UTSW 10 76321493 missense probably damaging 1.00
R4849:Dip2a UTSW 10 76294533 missense probably damaging 1.00
R4892:Dip2a UTSW 10 76280759 missense probably benign 0.02
R4998:Dip2a UTSW 10 76319556 nonsense probably null
R5068:Dip2a UTSW 10 76318043 missense possibly damaging 0.82
R5253:Dip2a UTSW 10 76299997 missense probably damaging 1.00
R5304:Dip2a UTSW 10 76294523 missense possibly damaging 0.67
R5324:Dip2a UTSW 10 76296393 missense probably damaging 1.00
R5369:Dip2a UTSW 10 76292360 missense probably damaging 1.00
R6272:Dip2a UTSW 10 76286407 makesense probably null
R6884:Dip2a UTSW 10 76272532 critical splice donor site probably null
R7143:Dip2a UTSW 10 76297791 missense probably damaging 1.00
R7247:Dip2a UTSW 10 76272532 critical splice donor site probably null
R7252:Dip2a UTSW 10 76273202 missense not run
R7327:Dip2a UTSW 10 76272562 missense probably benign 0.41
R7334:Dip2a UTSW 10 76274246 missense possibly damaging 0.91
R7349:Dip2a UTSW 10 76285592 missense probably damaging 1.00
R7360:Dip2a UTSW 10 76278560 missense probably damaging 1.00
R7513:Dip2a UTSW 10 76313235 missense probably benign
Z1088:Dip2a UTSW 10 76285628 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACGTGTTCAAGTGAGCCCAC -3'
(R):5'- ATCAACTCTGCCTAGGGTGG -3'

Sequencing Primer
(F):5'- GTGTTCAAGTGAGCCCACAATGTC -3'
(R):5'- GGGACCATGAGCCCTTGTG -3'
Posted On2016-06-21