Mutagenetix > Incidental Mutations

Incidental Mutation 'R5141:Ctsg'

396491

Institutional Source

Beutler Lab

Gene Symbol

Ctsg

Ensembl Gene

ENSMUSG00000040314

Gene Name

cathepsin G

Synonyms

MMRRC Submission

042727-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

R5141 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

56099881-56102574 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 56101727 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 25 (R25*)

Ref Sequence

ENSEMBL: ENSMUSP00000015583 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015583]

Predicted Effect

probably null
Transcript: ENSMUST00000015583
AA Change: R25*

SMART Domains

Protein: ENSMUSP00000015583
Gene: ENSMUSG00000040314
AA Change: R25*

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Tryp_SPc	20	238	5.65e-83	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225312

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

96% (76/79)

MGI Phenotype

FUNCTION: This gene encodes a member of the peptidase S1 (chymotrypsin) family of serine endopeptidases. The encoded preproprotein is proteolytically processed to generate a mature protein product. This product appears to play a role in host defense, including inflammation and antigen processing. Homozygous knockout mice for this gene exhibit enhanced susceptibility to bacterial and fungal infection. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased susceptibility to bacterial infection induced mortality but increased susceptibility to mortality induced by fungal infection. Mice either homozygous or heterozygous for a knock-in allele develop an abrupt onset, rapidly fatal acute leukemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamdec1	A	G	14: 68,573,128	V193A	probably benign	Het
Adamts18	T	A	8: 113,775,270	T320S	probably damaging	Het
Adamtsl1	G	T	4: 86,156,850	M151I	possibly damaging	Het
Adgrv1	A	T	13: 81,270,918	V5986E	probably damaging	Het
Aifm3	A	G	16: 17,499,722	E69G	probably damaging	Het
Akap13	C	A	7: 75,609,614	T662K	probably benign	Het
Alms1	A	G	6: 85,621,432	D1080G	probably benign	Het
Als2	T	C	1: 59,170,452	E1457G	possibly damaging	Het
Apobec4	A	G	1: 152,756,213		probably benign	Het
Apoo-ps	C	T	13: 107,414,395		noncoding transcript	Het
Aspscr1	G	A	11: 120,689,177	V181I	probably benign	Het
Atrn	T	C	2: 130,999,130		probably benign	Het
C3	T	A	17: 57,219,570	I804F	probably damaging	Het
Cbfa2t3	C	T	8: 122,635,021	G421R	probably benign	Het
Chmp4c	A	G	3: 10,367,153	E41G	probably damaging	Het
Clk4	T	A	11: 51,275,771	F96L	possibly damaging	Het
Cul1	A	G	6: 47,520,839	D618G	probably benign	Het
Cylc2	T	C	4: 51,228,587		probably benign	Het
Dip2a	G	A	10: 76,270,453	T1326I	probably damaging	Het
Etnk2	A	G	1: 133,368,862	I210V	probably benign	Het
Gm5773	T	A	3: 93,773,727	D235E	probably benign	Het
Gm7353	T	C	7: 3,111,001		noncoding transcript	Het
Gpi1	G	A	7: 34,227,096		probably benign	Het
Ing4	T	C	6: 125,039,874	M5T	probably benign	Het
Inpp4a	A	G	1: 37,380,087	I583V	probably benign	Het
Isyna1	T	C	8: 70,594,893	V64A	probably damaging	Het
Katnal2	T	A	18: 76,997,641	D310V	probably damaging	Het
Kbtbd8	A	G	6: 95,121,839	T126A	probably damaging	Het
Kif13a	T	C	13: 46,752,721	D582G	probably benign	Het
Lmf2	G	A	15: 89,351,607		probably null	Het
Lrp2	T	C	2: 69,552,349		probably null	Het
Lrp4	T	C	2: 91,478,678		probably benign	Het
Lyzl1	A	C	18: 4,169,209	D71A	possibly damaging	Het
Mak	C	T	13: 41,032,563	C543Y	possibly damaging	Het
Mapk8ip1	T	C	2: 92,386,765	D404G	probably damaging	Het
Mdga1	C	T	17: 29,852,493	E385K	probably benign	Het
Mst1r	T	A	9: 107,912,241	I573N	probably damaging	Het
Muc5ac	T	A	7: 141,814,742	N2365K	possibly damaging	Het
Ncan	T	C	8: 70,112,837	E179G	probably damaging	Het
Nlgn2	C	T	11: 69,825,390	R775H	probably damaging	Het
Olfr1228	A	C	2: 89,249,129	Y176*	probably null	Het
Olfr44	A	G	9: 39,484,531	F238L	probably damaging	Het
Olfr975	T	G	9: 39,949,874	K299T	probably benign	Het
Pcolce	G	T	5: 137,605,750	Q352K	probably benign	Het
Peg3	G	T	7: 6,709,382	T947N	probably benign	Het
Pld3	C	T	7: 27,533,795	D344N	probably damaging	Het
Plec	A	C	15: 76,190,533	D411E	probably damaging	Het
Pmp2	C	T	3: 10,182,414	D72N	probably benign	Het
Ptpn9	T	C	9: 57,036,676	V278A	possibly damaging	Het
Rbm33	A	G	5: 28,352,689	H300R	probably damaging	Het
Rpgrip1l	T	C	8: 91,260,918	Q837R	probably benign	Het
Rwdd4a	T	C	8: 47,550,674		probably benign	Het
Sema6a	T	C	18: 47,248,388	T1048A	probably damaging	Het
Senp1	G	A	15: 98,076,607	A108V	probably benign	Het
Serpine2	G	T	1: 79,802,863	Q290K	possibly damaging	Het
Sesn1	A	G	10: 41,811,101	N27S	probably benign	Het
Shroom1	T	A	11: 53,463,982	L243*	probably null	Het
Slc17a5	A	G	9: 78,540,988	Y395H	probably damaging	Het
Slc5a8	T	C	10: 88,919,560		probably null	Het
Sptbn5	G	A	2: 120,061,731	S1083F	probably benign	Het
Stx4a	T	A	7: 127,846,615	V231E	probably damaging	Het
Swt1	A	T	1: 151,411,394	S116T	probably benign	Het
Syt9	C	T	7: 107,504,219	T408I	probably damaging	Het
Tgm7	T	C	2: 121,100,999	T228A	probably benign	Het
Tmem115	A	G	9: 107,537,942	D310G	probably benign	Het
Trcg1	G	A	9: 57,241,304	G53D	probably damaging	Het
Tsfm	T	C	10: 127,029,613	K100E	probably damaging	Het
Usp1	A	G	4: 98,934,209	T587A	probably damaging	Het
Vcpip1	G	T	1: 9,748,077	A27E	unknown	Het
Vmn2r49	T	C	7: 9,986,373	N397S	probably benign	Het
Vmn2r8	A	G	5: 108,808,706	S17P	probably damaging	Het
Vwa3b	A	G	1: 37,187,021		probably benign	Het
Ythdc2	T	A	18: 44,865,047	S1094T	probably benign	Het
Zbtb22	C	G	17: 33,918,636	S585C	possibly damaging	Het
Zhx2	A	G	15: 57,821,786	T184A	probably benign	Het

Other mutations in Ctsg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02441:Ctsg	APN	14	56102412	missense	probably benign
IGL03092:Ctsg	APN	14	56099960	makesense	probably null
R0032:Ctsg	UTSW	14	56101739	missense	probably damaging	1.00
R0032:Ctsg	UTSW	14	56101739	missense	probably damaging	1.00
R1777:Ctsg	UTSW	14	56100601	missense	probably damaging	1.00
R6376:Ctsg	UTSW	14	56101653	nonsense	probably null
R7097:Ctsg	UTSW	14	56100032	missense	probably damaging	0.98
R7508:Ctsg	UTSW	14	56100541	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CATACGTTCAGGCTCTGTGGAG -3'
(R):5'- CGAGTCTCCCTTCAAACTAGG -3'

Sequencing Primer
(F):5'- GGGAGTCTGGGGACACTGAC -3'
(R):5'- GAGTAACTCCTGTGAAGTCTTAGC -3'

Posted On

2016-06-21