Incidental Mutation 'R5141:Ythdc2'
ID396502
Institutional Source Beutler Lab
Gene Symbol Ythdc2
Ensembl Gene ENSMUSG00000034653
Gene NameYTH domain containing 2
Synonyms3010002F02Rik
MMRRC Submission 042727-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5141 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location44827746-44889724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44865047 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1094 (S1094T)
Ref Sequence ENSEMBL: ENSMUSP00000048340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037763] [ENSMUST00000201507]
Predicted Effect probably benign
Transcript: ENSMUST00000037763
AA Change: S1094T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000048340
Gene: ENSMUSG00000034653
AA Change: S1094T

DomainStartEndE-ValueType
low complexity region 2 50 N/A INTRINSIC
Pfam:R3H 59 119 1.7e-15 PFAM
DEXDc 206 393 4.95e-26 SMART
low complexity region 413 428 N/A INTRINSIC
ANK 521 550 2.79e1 SMART
ANK 554 583 1.5e2 SMART
HELICc 648 759 5.31e-17 SMART
HA2 823 916 2.58e-22 SMART
Pfam:OB_NTP_bind 953 1082 1.3e-18 PFAM
low complexity region 1263 1299 N/A INTRINSIC
Pfam:YTH 1303 1434 7.2e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201507
AA Change: S439T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000144479
Gene: ENSMUSG00000034653
AA Change: S439T

DomainStartEndE-ValueType
HELICc 5 104 9.1e-19 SMART
HA2 168 261 2e-26 SMART
Pfam:OB_NTP_bind 298 427 6e-16 PFAM
low complexity region 570 582 N/A INTRINSIC
Meta Mutation Damage Score 0.1018 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (76/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH (Asp-Glu-Ala-His) subfamily of proteins, part of the DEAD (Asp-Glu-Ala-Asp) box family of RNA helicases. The encoded protein binds to N6-methyladenosine, a common modified RNA nucleotide that is enriched in the stop codons and 3' UTRs of eukaryotic messenger RNAs. Binding of proteins to this modified nucleotide may regulate mRNA translation and stability. This gene may be associated with susceptibility to pancreatic cancer in human patients, and knockdown of this gene resulted in reduced proliferation in a human liver cancer cell line. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female and male infertility with arrested meiosis and small gonads. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A G 14: 68,573,128 V193A probably benign Het
Adamts18 T A 8: 113,775,270 T320S probably damaging Het
Adamtsl1 G T 4: 86,156,850 M151I possibly damaging Het
Adgrv1 A T 13: 81,270,918 V5986E probably damaging Het
Aifm3 A G 16: 17,499,722 E69G probably damaging Het
Akap13 C A 7: 75,609,614 T662K probably benign Het
Alms1 A G 6: 85,621,432 D1080G probably benign Het
Als2 T C 1: 59,170,452 E1457G possibly damaging Het
Apobec4 A G 1: 152,756,213 probably benign Het
Apoo-ps C T 13: 107,414,395 noncoding transcript Het
Aspscr1 G A 11: 120,689,177 V181I probably benign Het
Atrn T C 2: 130,999,130 probably benign Het
C3 T A 17: 57,219,570 I804F probably damaging Het
Cbfa2t3 C T 8: 122,635,021 G421R probably benign Het
Chmp4c A G 3: 10,367,153 E41G probably damaging Het
Clk4 T A 11: 51,275,771 F96L possibly damaging Het
Ctsg G A 14: 56,101,727 R25* probably null Het
Cul1 A G 6: 47,520,839 D618G probably benign Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dip2a G A 10: 76,270,453 T1326I probably damaging Het
Etnk2 A G 1: 133,368,862 I210V probably benign Het
Gm5773 T A 3: 93,773,727 D235E probably benign Het
Gm7353 T C 7: 3,111,001 noncoding transcript Het
Gpi1 G A 7: 34,227,096 probably benign Het
Ing4 T C 6: 125,039,874 M5T probably benign Het
Inpp4a A G 1: 37,380,087 I583V probably benign Het
Isyna1 T C 8: 70,594,893 V64A probably damaging Het
Katnal2 T A 18: 76,997,641 D310V probably damaging Het
Kbtbd8 A G 6: 95,121,839 T126A probably damaging Het
Kif13a T C 13: 46,752,721 D582G probably benign Het
Lmf2 G A 15: 89,351,607 probably null Het
Lrp2 T C 2: 69,552,349 probably null Het
Lrp4 T C 2: 91,478,678 probably benign Het
Lyzl1 A C 18: 4,169,209 D71A possibly damaging Het
Mak C T 13: 41,032,563 C543Y possibly damaging Het
Mapk8ip1 T C 2: 92,386,765 D404G probably damaging Het
Mdga1 C T 17: 29,852,493 E385K probably benign Het
Mst1r T A 9: 107,912,241 I573N probably damaging Het
Muc5ac T A 7: 141,814,742 N2365K possibly damaging Het
Ncan T C 8: 70,112,837 E179G probably damaging Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1228 A C 2: 89,249,129 Y176* probably null Het
Olfr44 A G 9: 39,484,531 F238L probably damaging Het
Olfr975 T G 9: 39,949,874 K299T probably benign Het
Pcolce G T 5: 137,605,750 Q352K probably benign Het
Peg3 G T 7: 6,709,382 T947N probably benign Het
Pld3 C T 7: 27,533,795 D344N probably damaging Het
Plec A C 15: 76,190,533 D411E probably damaging Het
Pmp2 C T 3: 10,182,414 D72N probably benign Het
Ptpn9 T C 9: 57,036,676 V278A possibly damaging Het
Rbm33 A G 5: 28,352,689 H300R probably damaging Het
Rpgrip1l T C 8: 91,260,918 Q837R probably benign Het
Rwdd4a T C 8: 47,550,674 probably benign Het
Sema6a T C 18: 47,248,388 T1048A probably damaging Het
Senp1 G A 15: 98,076,607 A108V probably benign Het
Serpine2 G T 1: 79,802,863 Q290K possibly damaging Het
Sesn1 A G 10: 41,811,101 N27S probably benign Het
Shroom1 T A 11: 53,463,982 L243* probably null Het
Slc17a5 A G 9: 78,540,988 Y395H probably damaging Het
Slc5a8 T C 10: 88,919,560 probably null Het
Sptbn5 G A 2: 120,061,731 S1083F probably benign Het
Stx4a T A 7: 127,846,615 V231E probably damaging Het
Swt1 A T 1: 151,411,394 S116T probably benign Het
Syt9 C T 7: 107,504,219 T408I probably damaging Het
Tgm7 T C 2: 121,100,999 T228A probably benign Het
Tmem115 A G 9: 107,537,942 D310G probably benign Het
Trcg1 G A 9: 57,241,304 G53D probably damaging Het
Tsfm T C 10: 127,029,613 K100E probably damaging Het
Usp1 A G 4: 98,934,209 T587A probably damaging Het
Vcpip1 G T 1: 9,748,077 A27E unknown Het
Vmn2r49 T C 7: 9,986,373 N397S probably benign Het
Vmn2r8 A G 5: 108,808,706 S17P probably damaging Het
Vwa3b A G 1: 37,187,021 probably benign Het
Zbtb22 C G 17: 33,918,636 S585C possibly damaging Het
Zhx2 A G 15: 57,821,786 T184A probably benign Het
Other mutations in Ythdc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ythdc2 APN 18 44859973 missense probably benign
IGL00341:Ythdc2 APN 18 44850397 missense probably benign 0.00
IGL00502:Ythdc2 APN 18 44847812 missense probably damaging 0.99
IGL00585:Ythdc2 APN 18 44864361 missense probably damaging 1.00
IGL01081:Ythdc2 APN 18 44850659 missense probably benign 0.19
IGL01569:Ythdc2 APN 18 44887651 missense probably benign
IGL01577:Ythdc2 APN 18 44858282 missense probably benign 0.00
IGL01617:Ythdc2 APN 18 44841415 missense possibly damaging 0.53
IGL01674:Ythdc2 APN 18 44860404 missense probably benign 0.04
IGL01736:Ythdc2 APN 18 44850668 missense probably damaging 0.97
IGL02095:Ythdc2 APN 18 44873140 splice site probably benign
IGL02245:Ythdc2 APN 18 44862684 missense possibly damaging 0.74
IGL02524:Ythdc2 APN 18 44847854 missense probably damaging 0.98
IGL02542:Ythdc2 APN 18 44840241 missense probably damaging 1.00
IGL02622:Ythdc2 APN 18 44859934 missense probably damaging 0.99
IGL02795:Ythdc2 APN 18 44837438 missense possibly damaging 0.95
IGL02935:Ythdc2 APN 18 44855045 missense probably damaging 1.00
PIT4618001:Ythdc2 UTSW 18 44834598 missense probably benign 0.19
R0115:Ythdc2 UTSW 18 44841423 splice site probably benign
R0329:Ythdc2 UTSW 18 44865060 splice site probably benign
R0472:Ythdc2 UTSW 18 44864357 missense probably benign 0.02
R0530:Ythdc2 UTSW 18 44850398 missense probably damaging 0.99
R0547:Ythdc2 UTSW 18 44840264 missense possibly damaging 0.92
R0563:Ythdc2 UTSW 18 44864848 splice site probably benign
R0609:Ythdc2 UTSW 18 44864357 missense probably benign 0.02
R1291:Ythdc2 UTSW 18 44855209 missense probably benign 0.33
R1469:Ythdc2 UTSW 18 44864462 missense probably benign 0.00
R1469:Ythdc2 UTSW 18 44864462 missense probably benign 0.00
R1724:Ythdc2 UTSW 18 44828690 missense probably benign 0.04
R1860:Ythdc2 UTSW 18 44872956 missense possibly damaging 0.86
R2040:Ythdc2 UTSW 18 44855174 nonsense probably null
R2308:Ythdc2 UTSW 18 44847748 missense possibly damaging 0.95
R3711:Ythdc2 UTSW 18 44833173 missense probably damaging 0.98
R4005:Ythdc2 UTSW 18 44833128 missense probably benign 0.00
R4580:Ythdc2 UTSW 18 44858198 missense possibly damaging 0.81
R4631:Ythdc2 UTSW 18 44887631 missense probably benign 0.03
R4815:Ythdc2 UTSW 18 44885240 missense probably benign 0.40
R4924:Ythdc2 UTSW 18 44847804 missense probably damaging 1.00
R4982:Ythdc2 UTSW 18 44871465 missense probably benign 0.01
R5011:Ythdc2 UTSW 18 44854742 missense probably benign 0.38
R5147:Ythdc2 UTSW 18 44844292 missense probably damaging 0.98
R5280:Ythdc2 UTSW 18 44860621 missense probably damaging 1.00
R5388:Ythdc2 UTSW 18 44857025 missense possibly damaging 0.65
R5928:Ythdc2 UTSW 18 44833205 missense probably benign
R5931:Ythdc2 UTSW 18 44872956 missense possibly damaging 0.86
R5995:Ythdc2 UTSW 18 44886253 missense probably damaging 1.00
R6027:Ythdc2 UTSW 18 44860436 missense probably benign 0.02
R6056:Ythdc2 UTSW 18 44840210 missense probably damaging 0.98
R6318:Ythdc2 UTSW 18 44860377 missense probably benign 0.04
R6399:Ythdc2 UTSW 18 44886402 missense possibly damaging 0.93
R6586:Ythdc2 UTSW 18 44845788 missense probably benign 0.00
R6684:Ythdc2 UTSW 18 44873069 missense possibly damaging 0.47
R7040:Ythdc2 UTSW 18 44834462 missense probably benign 0.02
R7071:Ythdc2 UTSW 18 44845788 missense probably benign 0.00
R7105:Ythdc2 UTSW 18 44834563 missense probably damaging 1.00
R7148:Ythdc2 UTSW 18 44833122 missense probably benign 0.42
R7290:Ythdc2 UTSW 18 44837491 missense possibly damaging 0.50
R7806:Ythdc2 UTSW 18 44844286 missense possibly damaging 0.91
R7806:Ythdc2 UTSW 18 44850424 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AATAGATTCCTCCCGCCAATGG -3'
(R):5'- CCTGTCTCAGTATATCAAATATGCC -3'

Sequencing Primer
(F):5'- AATGGTCAGGCTGCAGC -3'
(R):5'- ATACACCTCAGTATTCCCTAACTATC -3'
Posted On2016-06-21