Incidental Mutation 'R5141:Katnal2'
ID396504
Institutional Source Beutler Lab
Gene Symbol Katnal2
Ensembl Gene ENSMUSG00000025420
Gene Namekatanin p60 subunit A-like 2
Synonyms4933439B08Rik, 3110023G01Rik
MMRRC Submission 042727-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5141 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location76977148-77047308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76997641 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 310 (D310V)
Ref Sequence ENSEMBL: ENSMUSP00000117495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026486] [ENSMUST00000122984] [ENSMUST00000126153] [ENSMUST00000135029] [ENSMUST00000137354] [ENSMUST00000137498]
Predicted Effect probably damaging
Transcript: ENSMUST00000026486
AA Change: D354V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026486
Gene: ENSMUSG00000025420
AA Change: D354V

DomainStartEndE-ValueType
LisH 25 57 8.53e-6 SMART
AAA 287 400 6.46e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125744
Predicted Effect probably damaging
Transcript: ENSMUST00000126153
AA Change: D354V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122079
Gene: ENSMUSG00000025420
AA Change: D354V

DomainStartEndE-ValueType
LisH 25 57 8.53e-6 SMART
AAA 287 425 1.74e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135029
AA Change: D354V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115411
Gene: ENSMUSG00000025420
AA Change: D354V

DomainStartEndE-ValueType
LisH 25 57 8.53e-6 SMART
AAA 287 372 2.95e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000137354
AA Change: D92V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118511
Gene: ENSMUSG00000025420
AA Change: D92V

DomainStartEndE-ValueType
AAA 25 163 1.74e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000137498
AA Change: D310V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117495
Gene: ENSMUSG00000025420
AA Change: D310V

DomainStartEndE-ValueType
AAA 243 381 1.74e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154053
Meta Mutation Damage Score 0.9677 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (76/79)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A G 14: 68,573,128 V193A probably benign Het
Adamts18 T A 8: 113,775,270 T320S probably damaging Het
Adamtsl1 G T 4: 86,156,850 M151I possibly damaging Het
Adgrv1 A T 13: 81,270,918 V5986E probably damaging Het
Aifm3 A G 16: 17,499,722 E69G probably damaging Het
Akap13 C A 7: 75,609,614 T662K probably benign Het
Alms1 A G 6: 85,621,432 D1080G probably benign Het
Als2 T C 1: 59,170,452 E1457G possibly damaging Het
Apobec4 A G 1: 152,756,213 probably benign Het
Apoo-ps C T 13: 107,414,395 noncoding transcript Het
Aspscr1 G A 11: 120,689,177 V181I probably benign Het
Atrn T C 2: 130,999,130 probably benign Het
C3 T A 17: 57,219,570 I804F probably damaging Het
Cbfa2t3 C T 8: 122,635,021 G421R probably benign Het
Chmp4c A G 3: 10,367,153 E41G probably damaging Het
Clk4 T A 11: 51,275,771 F96L possibly damaging Het
Ctsg G A 14: 56,101,727 R25* probably null Het
Cul1 A G 6: 47,520,839 D618G probably benign Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dip2a G A 10: 76,270,453 T1326I probably damaging Het
Etnk2 A G 1: 133,368,862 I210V probably benign Het
Gm5773 T A 3: 93,773,727 D235E probably benign Het
Gm7353 T C 7: 3,111,001 noncoding transcript Het
Gpi1 G A 7: 34,227,096 probably benign Het
Ing4 T C 6: 125,039,874 M5T probably benign Het
Inpp4a A G 1: 37,380,087 I583V probably benign Het
Isyna1 T C 8: 70,594,893 V64A probably damaging Het
Kbtbd8 A G 6: 95,121,839 T126A probably damaging Het
Kif13a T C 13: 46,752,721 D582G probably benign Het
Lmf2 G A 15: 89,351,607 probably null Het
Lrp2 T C 2: 69,552,349 probably null Het
Lrp4 T C 2: 91,478,678 probably benign Het
Lyzl1 A C 18: 4,169,209 D71A possibly damaging Het
Mak C T 13: 41,032,563 C543Y possibly damaging Het
Mapk8ip1 T C 2: 92,386,765 D404G probably damaging Het
Mdga1 C T 17: 29,852,493 E385K probably benign Het
Mst1r T A 9: 107,912,241 I573N probably damaging Het
Muc5ac T A 7: 141,814,742 N2365K possibly damaging Het
Ncan T C 8: 70,112,837 E179G probably damaging Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1228 A C 2: 89,249,129 Y176* probably null Het
Olfr44 A G 9: 39,484,531 F238L probably damaging Het
Olfr975 T G 9: 39,949,874 K299T probably benign Het
Pcolce G T 5: 137,605,750 Q352K probably benign Het
Peg3 G T 7: 6,709,382 T947N probably benign Het
Pld3 C T 7: 27,533,795 D344N probably damaging Het
Plec A C 15: 76,190,533 D411E probably damaging Het
Pmp2 C T 3: 10,182,414 D72N probably benign Het
Ptpn9 T C 9: 57,036,676 V278A possibly damaging Het
Rbm33 A G 5: 28,352,689 H300R probably damaging Het
Rpgrip1l T C 8: 91,260,918 Q837R probably benign Het
Rwdd4a T C 8: 47,550,674 probably benign Het
Sema6a T C 18: 47,248,388 T1048A probably damaging Het
Senp1 G A 15: 98,076,607 A108V probably benign Het
Serpine2 G T 1: 79,802,863 Q290K possibly damaging Het
Sesn1 A G 10: 41,811,101 N27S probably benign Het
Shroom1 T A 11: 53,463,982 L243* probably null Het
Slc17a5 A G 9: 78,540,988 Y395H probably damaging Het
Slc5a8 T C 10: 88,919,560 probably null Het
Sptbn5 G A 2: 120,061,731 S1083F probably benign Het
Stx4a T A 7: 127,846,615 V231E probably damaging Het
Swt1 A T 1: 151,411,394 S116T probably benign Het
Syt9 C T 7: 107,504,219 T408I probably damaging Het
Tgm7 T C 2: 121,100,999 T228A probably benign Het
Tmem115 A G 9: 107,537,942 D310G probably benign Het
Trcg1 G A 9: 57,241,304 G53D probably damaging Het
Tsfm T C 10: 127,029,613 K100E probably damaging Het
Usp1 A G 4: 98,934,209 T587A probably damaging Het
Vcpip1 G T 1: 9,748,077 A27E unknown Het
Vmn2r49 T C 7: 9,986,373 N397S probably benign Het
Vmn2r8 A G 5: 108,808,706 S17P probably damaging Het
Vwa3b A G 1: 37,187,021 probably benign Het
Ythdc2 T A 18: 44,865,047 S1094T probably benign Het
Zbtb22 C G 17: 33,918,636 S585C possibly damaging Het
Zhx2 A G 15: 57,821,786 T184A probably benign Het
Other mutations in Katnal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Katnal2 APN 18 77002754 missense probably damaging 1.00
IGL00976:Katnal2 APN 18 77017493 missense probably damaging 1.00
IGL01012:Katnal2 APN 18 77017554 missense probably damaging 0.96
IGL01302:Katnal2 APN 18 77047167 splice site probably benign
IGL01377:Katnal2 APN 18 77002457 missense probably damaging 1.00
IGL01532:Katnal2 APN 18 77012000 missense probably benign
IGL03203:Katnal2 APN 18 77007524 missense probably damaging 1.00
R0592:Katnal2 UTSW 18 77002560 splice site probably null
R1348:Katnal2 UTSW 18 76978542 splice site probably null
R1419:Katnal2 UTSW 18 76977432 missense possibly damaging 0.85
R1755:Katnal2 UTSW 18 77012067 missense probably benign 0.01
R1772:Katnal2 UTSW 18 77002537 missense probably damaging 1.00
R1852:Katnal2 UTSW 18 77016023 missense probably benign 0.08
R1952:Katnal2 UTSW 18 76980011 missense probably benign 0.00
R2115:Katnal2 UTSW 18 76980091 missense probably damaging 1.00
R2155:Katnal2 UTSW 18 77010941 missense probably benign 0.01
R4765:Katnal2 UTSW 18 76977543 intron probably null
R5126:Katnal2 UTSW 18 77017598 missense probably benign 0.13
R5315:Katnal2 UTSW 18 77012009 missense probably benign 0.02
R5358:Katnal2 UTSW 18 77017494 missense possibly damaging 0.47
R5412:Katnal2 UTSW 18 77002435 missense probably damaging 1.00
R6289:Katnal2 UTSW 18 77017455 unclassified probably null
R6647:Katnal2 UTSW 18 76980037 missense probably benign 0.01
R6919:Katnal2 UTSW 18 77011038 missense probably benign 0.05
R7039:Katnal2 UTSW 18 77047172 critical splice donor site probably null
R7285:Katnal2 UTSW 18 76993575 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TTCTGTGTCCCTGCAGAAAATC -3'
(R):5'- TGGTTATAAGGGTGCCTCCGAG -3'

Sequencing Primer
(F):5'- CCCTGCAGAAAATCTGTGGGC -3'
(R):5'- CCTCCGAGTACCATTGTAGGATG -3'
Posted On2016-06-21