Mutagenetix > Incidental Mutations

Incidental Mutation 'R5143:Pomt1'

396507

Institutional Source

Beutler Lab

Gene Symbol

Pomt1

Ensembl Gene

ENSMUSG00000039254

Gene Name

protein-O-mannosyltransferase 1

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.119) question?

Stock #

R5143 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32236590-32255005 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 32254329 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 709 (A709E)

Ref Sequence

ENSEMBL: ENSMUSP00000038722 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002625] [ENSMUST00000036473]

Predicted Effect

probably benign
Transcript: ENSMUST00000002625

SMART Domains

Protein: ENSMUSP00000002625
Gene: ENSMUSG00000002550

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
Pfam:CoaE	30	198	1.1e-8	PFAM
Pfam:AAA_17	31	188	3.8e-8	PFAM
Pfam:PRK	31	225	1.9e-53	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000036473
AA Change: A709E

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000038722
Gene: ENSMUSG00000039254
AA Change: A709E

Domain	Start	End	E-Value	Type
Pfam:PMT	42	289	2.8e-96	PFAM
MIR	318	381	7.45e-8	SMART
MIR	392	449	1.65e-9	SMART
MIR	456	513	6.2e-5	SMART
Pfam:PMT_4TMC	542	740	3.9e-50	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129163

Predicted Effect

probably benign
Transcript: ENSMUST00000132516

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133804

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134351

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138000

Predicted Effect

probably benign
Transcript: ENSMUST00000138133

SMART Domains

Protein: ENSMUSP00000125350
Gene: ENSMUSG00000002550

Domain	Start	End	E-Value	Type
Pfam:PRK	1	151	1e-42	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142797

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151598

Predicted Effect

probably benign
Transcript: ENSMUST00000192998

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an O-mannosyltransferase that requires interaction with the product of the POMT2 gene for enzymatic function. The encoded protein is found in the membrane of the endoplasmic reticulum. Defects in this gene are a cause of Walker-Warburg syndrome (WWS) and limb-girdle muscular dystrophy type 2K (LGMD2K). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene with one allele results in embryonic lethality with disruption of Reichert's membrane. Heterozygous mutation with a second allele results in ectasia in kidney and liver veins and an increased neutrophil count. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	C	T	5: 109,739,198		probably null	Het
Abcc2	T	C	19: 43,821,661	I886T	probably benign	Het
Adrb2	T	C	18: 62,178,776	Y326C	probably damaging	Het
AF366264	A	G	8: 13,836,844	S416P	possibly damaging	Het
Aplp1	G	A	7: 30,441,123	R334C	probably damaging	Het
AY358078	T	C	14: 51,802,549	S39P	unknown	Het
Bpifb2	A	T	2: 153,878,504	D61V	probably damaging	Het
Caap1	A	T	4: 94,501,382	N238K	probably damaging	Het
Cfap54	A	G	10: 93,029,158	V726A	possibly damaging	Het
Chrna7	T	C	7: 63,106,147	Y217C	probably damaging	Het
Crocc	T	A	4: 141,041,039	T414S	probably benign	Het
Cyp2a12	A	G	7: 27,036,611	I482V	probably benign	Het
Dnah6	A	T	6: 73,181,761	F620I	possibly damaging	Het
Eogt	A	G	6: 97,125,584	L256P	probably damaging	Het
F5	A	G	1: 164,211,828	I2002M	probably damaging	Het
Foxp1	A	G	6: 98,945,532		probably null	Het
Fut8	A	G	12: 77,365,209	D111G	probably benign	Het
Gm17689	T	A	9: 36,581,904	N41Y	probably benign	Het
Golgb1	C	T	16: 36,898,689	A319V	probably benign	Het
Hoxd3	C	T	2: 74,746,372	R39C	probably damaging	Het
Mfng	C	T	15: 78,764,388	R163H	probably benign	Het
Olfr690	T	A	7: 105,329,524	I223F	probably damaging	Het
Pcdhb2	A	G	18: 37,296,732	Y586C	probably damaging	Het
Plcd1	G	A	9: 119,074,451	Q442*	probably null	Het
Plppr5	A	G	3: 117,625,903	T207A	probably benign	Het
Prmt8	A	G	6: 127,732,714	M61T	probably benign	Het
Ptpn23	A	G	9: 110,385,438		probably benign	Het
Sbf2	T	A	7: 110,422,540	K493*	probably null	Het
Tmc2	A	T	2: 130,234,818	S355C	probably damaging	Het
Tonsl	A	G	15: 76,636,657	S399P	possibly damaging	Het
Ttc14	T	C	3: 33,808,901		probably benign	Het
Ttn	A	G	2: 76,738,065	S19168P	probably damaging	Het
Usp17lb	A	T	7: 104,841,478	S80T	probably damaging	Het
Vmn2r96	A	G	17: 18,583,858	I457V	possibly damaging	Het
Wdr64	G	T	1: 175,726,413	D170Y	probably damaging	Het
Zbtb42	T	C	12: 112,679,514	V41A	probably damaging	Het

Other mutations in Pomt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Pomt1	APN	2	32241772	missense	probably benign
IGL01926:Pomt1	APN	2	32243472	missense	probably benign	0.23
IGL02237:Pomt1	APN	2	32245677	missense	probably benign	0.18
IGL02281:Pomt1	APN	2	32248646	missense	possibly damaging	0.95
IGL03001:Pomt1	APN	2	32244326	missense	probably benign
IGL03216:Pomt1	APN	2	32242943	missense	probably damaging	0.99
IGL03343:Pomt1	APN	2	32253712	splice site	probably benign
R0049:Pomt1	UTSW	2	32252011	missense	possibly damaging	0.88
R0049:Pomt1	UTSW	2	32252011	missense	possibly damaging	0.88
R0975:Pomt1	UTSW	2	32253895	critical splice donor site	probably null
R1199:Pomt1	UTSW	2	32250492	missense	probably benign
R1414:Pomt1	UTSW	2	32243610	splice site	probably benign
R1421:Pomt1	UTSW	2	32236753	unclassified	probably benign
R1806:Pomt1	UTSW	2	32241668	missense	probably damaging	1.00
R2173:Pomt1	UTSW	2	32250900	missense	probably damaging	1.00
R2209:Pomt1	UTSW	2	32250862	missense	possibly damaging	0.90
R2302:Pomt1	UTSW	2	32243659	missense	probably benign	0.00
R3084:Pomt1	UTSW	2	32244240	missense	probably benign	0.02
R3774:Pomt1	UTSW	2	32244250	missense	possibly damaging	0.93
R3933:Pomt1	UTSW	2	32245619	missense	probably benign	0.00
R4177:Pomt1	UTSW	2	32248677	missense	probably damaging	0.99
R4626:Pomt1	UTSW	2	32254412	missense	possibly damaging	0.84
R4645:Pomt1	UTSW	2	32242876	intron	probably benign
R4864:Pomt1	UTSW	2	32251992	missense	probably benign	0.02
R4911:Pomt1	UTSW	2	32241679	missense	probably damaging	0.97
R5288:Pomt1	UTSW	2	32244299	nonsense	probably null
R5385:Pomt1	UTSW	2	32244299	nonsense	probably null
R5718:Pomt1	UTSW	2	32248692	missense	possibly damaging	0.91
R5735:Pomt1	UTSW	2	32243505	missense	probably damaging	1.00
R5754:Pomt1	UTSW	2	32247590	missense	probably damaging	0.99
R5817:Pomt1	UTSW	2	32248679	missense	probably damaging	0.97
R6304:Pomt1	UTSW	2	32250790	missense	probably damaging	1.00
R6477:Pomt1	UTSW	2	32248716	splice site	probably null
R6793:Pomt1	UTSW	2	32242949	missense	probably damaging	1.00
R6918:Pomt1	UTSW	2	32252861	splice site	probably null
R7114:Pomt1	UTSW	2	32253836	missense	probably benign	0.41
R8140:Pomt1	UTSW	2	32244297	missense	probably damaging	1.00
R8380:Pomt1	UTSW	2	32245607	missense	probably damaging	1.00
Z1177:Pomt1	UTSW	2	32237089	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- TGTGCACAATGTGTATAAGCAGG -3'
(R):5'- GGTGGGAGACAAACACATCTTTG -3'

Sequencing Primer
(F):5'- TGCACAATGTGTATAAGCAGGTAAGG -3'
(R):5'- GAGACAAACACATCTTTGAGGCTTTG -3'

Posted On

2016-06-21