Incidental Mutation 'R5143:Hoxd3'
ID396508
Institutional Source Beutler Lab
Gene Symbol Hoxd3
Ensembl Gene ENSMUSG00000079277
Gene Namehomeobox D3
SynonymsHox-4.1, Hox-5.5
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.894) question?
Stock #R5143 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location74711927-74748442 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74746372 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 39 (R39C)
Ref Sequence ENSEMBL: ENSMUSP00000134616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047830] [ENSMUST00000053932] [ENSMUST00000111982] [ENSMUST00000111983] [ENSMUST00000140666] [ENSMUST00000144544]
Predicted Effect probably damaging
Transcript: ENSMUST00000047830
AA Change: R199C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044809
Gene: ENSMUSG00000079277
AA Change: R199C

DomainStartEndE-ValueType
low complexity region 93 135 N/A INTRINSIC
low complexity region 141 159 N/A INTRINSIC
HOX 195 257 5.83e-28 SMART
Pfam:DUF4074 369 431 8.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053932
SMART Domains Protein: ENSMUSP00000051355
Gene: ENSMUSG00000100642

DomainStartEndE-ValueType
low complexity region 93 135 N/A INTRINSIC
low complexity region 141 159 N/A INTRINSIC
HOX 195 257 5.83e-28 SMART
Pfam:DUF4074 370 431 1.4e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100000
Predicted Effect probably damaging
Transcript: ENSMUST00000111982
AA Change: R199C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107613
Gene: ENSMUSG00000079277
AA Change: R199C

DomainStartEndE-ValueType
low complexity region 93 135 N/A INTRINSIC
low complexity region 141 159 N/A INTRINSIC
HOX 195 257 5.83e-28 SMART
Pfam:DUF4074 369 431 8.9e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111983
AA Change: R199C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107614
Gene: ENSMUSG00000079277
AA Change: R199C

DomainStartEndE-ValueType
low complexity region 93 135 N/A INTRINSIC
low complexity region 141 159 N/A INTRINSIC
HOX 195 257 5.83e-28 SMART
Pfam:DUF4074 369 431 8.9e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140666
AA Change: R39C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134616
Gene: ENSMUSG00000079277
AA Change: R39C

DomainStartEndE-ValueType
HOX 35 97 5.83e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230704
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located at 2q31-2q37 chromosome regions. Deletions that removed the entire HOXD gene cluster or 5' end of this cluster have been associated with severe limb and genital abnormalities. The protein encoded by this gene may play a role in the regulation of cell adhesion processes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show partial postnatal lethality, asymmetric rib-sternum attachment, and anterior transformations of the cervical vertebrae I (atlas) and II (axis). Mice homozygous for a different knock-out allele lack the anteriorarch of the atlas and the dens of the axis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,739,198 probably null Het
Abcc2 T C 19: 43,821,661 I886T probably benign Het
Adrb2 T C 18: 62,178,776 Y326C probably damaging Het
AF366264 A G 8: 13,836,844 S416P possibly damaging Het
Aplp1 G A 7: 30,441,123 R334C probably damaging Het
AY358078 T C 14: 51,802,549 S39P unknown Het
Bpifb2 A T 2: 153,878,504 D61V probably damaging Het
Caap1 A T 4: 94,501,382 N238K probably damaging Het
Cfap54 A G 10: 93,029,158 V726A possibly damaging Het
Chrna7 T C 7: 63,106,147 Y217C probably damaging Het
Crocc T A 4: 141,041,039 T414S probably benign Het
Cyp2a12 A G 7: 27,036,611 I482V probably benign Het
Dnah6 A T 6: 73,181,761 F620I possibly damaging Het
Eogt A G 6: 97,125,584 L256P probably damaging Het
F5 A G 1: 164,211,828 I2002M probably damaging Het
Foxp1 A G 6: 98,945,532 probably null Het
Fut8 A G 12: 77,365,209 D111G probably benign Het
Gm17689 T A 9: 36,581,904 N41Y probably benign Het
Golgb1 C T 16: 36,898,689 A319V probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Olfr690 T A 7: 105,329,524 I223F probably damaging Het
Pcdhb2 A G 18: 37,296,732 Y586C probably damaging Het
Plcd1 G A 9: 119,074,451 Q442* probably null Het
Plppr5 A G 3: 117,625,903 T207A probably benign Het
Pomt1 C A 2: 32,254,329 A709E probably benign Het
Prmt8 A G 6: 127,732,714 M61T probably benign Het
Ptpn23 A G 9: 110,385,438 probably benign Het
Sbf2 T A 7: 110,422,540 K493* probably null Het
Tmc2 A T 2: 130,234,818 S355C probably damaging Het
Tonsl A G 15: 76,636,657 S399P possibly damaging Het
Ttc14 T C 3: 33,808,901 probably benign Het
Ttn A G 2: 76,738,065 S19168P probably damaging Het
Usp17lb A T 7: 104,841,478 S80T probably damaging Het
Vmn2r96 A G 17: 18,583,858 I457V possibly damaging Het
Wdr64 G T 1: 175,726,413 D170Y probably damaging Het
Zbtb42 T C 12: 112,679,514 V41A probably damaging Het
Other mutations in Hoxd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02636:Hoxd3 APN 2 74746954 missense probably benign 0.32
IGL03017:Hoxd3 APN 2 74746706 missense possibly damaging 0.68
candide UTSW 2 74744076 missense probably damaging 1.00
compressed UTSW 2 74744306 nonsense probably null
R1977:Hoxd3 UTSW 2 74744276 missense possibly damaging 0.94
R2079:Hoxd3 UTSW 2 74744266 missense probably damaging 0.97
R2124:Hoxd3 UTSW 2 74744234 missense possibly damaging 0.92
R5250:Hoxd3 UTSW 2 74744306 nonsense probably null
R5256:Hoxd3 UTSW 2 74746867 missense possibly damaging 0.88
R5943:Hoxd3 UTSW 2 74746829 missense probably benign 0.00
R6300:Hoxd3 UTSW 2 74744076 missense probably damaging 1.00
R7362:Hoxd3 UTSW 2 74744219 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TTACAGGTGCGACTGACAGGTAG -3'
(R):5'- AATGCAGGATGCCCTTAGCC -3'

Sequencing Primer
(F):5'- ACTGACAGGTAGGCCCAG -3'
(R):5'- AGGATGCCCTTAGCCTTCTGG -3'
Posted On2016-06-21