Mutagenetix > Incidental Mutation

Incidental Mutation 'R5143:Hoxd3'

396508

Institutional Source

Beutler Lab

Gene Symbol

Hoxd3

Ensembl Gene

ENSMUSG00000079277

Gene Name

homeobox D3

Synonyms

Hox-5.5, Hox-4.1

Accession Numbers

Essential gene?

Probably essential (E-score: 0.823) question?

Stock #

R5143 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

74542337-74578615 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 74576716 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 39 (R39C)

Ref Sequence

ENSEMBL: ENSMUSP00000134616 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047830] [ENSMUST00000053932] [ENSMUST00000111982] [ENSMUST00000111983] [ENSMUST00000140666] [ENSMUST00000144544]

AlphaFold

P09027

Predicted Effect

probably damaging
Transcript: ENSMUST00000047830
AA Change: R199C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000044809
Gene: ENSMUSG00000079277
AA Change: R199C

Domain	Start	End	E-Value	Type
low complexity region	93	135	N/A	INTRINSIC
low complexity region	141	159	N/A	INTRINSIC
HOX	195	257	5.83e-28	SMART
Pfam:DUF4074	369	431	8.9e-35	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000053932

SMART Domains

Protein: ENSMUSP00000051355
Gene: ENSMUSG00000100642

Domain	Start	End	E-Value	Type
low complexity region	93	135	N/A	INTRINSIC
low complexity region	141	159	N/A	INTRINSIC
HOX	195	257	5.83e-28	SMART
Pfam:DUF4074	370	431	1.4e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000100000

Predicted Effect

probably damaging
Transcript: ENSMUST00000111982
AA Change: R199C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107613
Gene: ENSMUSG00000079277
AA Change: R199C

Domain	Start	End	E-Value	Type
low complexity region	93	135	N/A	INTRINSIC
low complexity region	141	159	N/A	INTRINSIC
HOX	195	257	5.83e-28	SMART
Pfam:DUF4074	369	431	8.9e-35	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111983
AA Change: R199C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107614
Gene: ENSMUSG00000079277
AA Change: R199C

Domain	Start	End	E-Value	Type
low complexity region	93	135	N/A	INTRINSIC
low complexity region	141	159	N/A	INTRINSIC
HOX	195	257	5.83e-28	SMART
Pfam:DUF4074	369	431	8.9e-35	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000140666
AA Change: R39C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000134616
Gene: ENSMUSG00000079277
AA Change: R39C

Domain	Start	End	E-Value	Type
HOX	35	97	5.83e-28	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000144544

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190553

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152462

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230341

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230511

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230540

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229136

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230704

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located at 2q31-2q37 chromosome regions. Deletions that removed the entire HOXD gene cluster or 5' end of this cluster have been associated with severe limb and genital abnormalities. The protein encoded by this gene may play a role in the regulation of cell adhesion processes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show partial postnatal lethality, asymmetric rib-sternum attachment, and anterior transformations of the cervical vertebrae I (atlas) and II (axis). Mice homozygous for a different knock-out allele lack the anteriorarch of the atlas and the dens of the axis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	C	T	5: 109,887,064 (GRCm39)		probably null	Het
Abcc2	T	C	19: 43,810,100 (GRCm39)	I886T	probably benign	Het
Adrb2	T	C	18: 62,311,847 (GRCm39)	Y326C	probably damaging	Het
Aplp1	G	A	7: 30,140,548 (GRCm39)	R334C	probably damaging	Het
AY358078	T	C	14: 52,040,006 (GRCm39)	S39P	unknown	Het
Bpifb2	A	T	2: 153,720,424 (GRCm39)	D61V	probably damaging	Het
Caap1	A	T	4: 94,389,619 (GRCm39)	N238K	probably damaging	Het
Cfap54	A	G	10: 92,865,020 (GRCm39)	V726A	possibly damaging	Het
Chrna7	T	C	7: 62,755,895 (GRCm39)	Y217C	probably damaging	Het
Crocc	T	A	4: 140,768,350 (GRCm39)	T414S	probably benign	Het
Cyp2a12	A	G	7: 26,736,036 (GRCm39)	I482V	probably benign	Het
Dnah6	A	T	6: 73,158,744 (GRCm39)	F620I	possibly damaging	Het
Eogt	A	G	6: 97,102,545 (GRCm39)	L256P	probably damaging	Het
F5	A	G	1: 164,039,397 (GRCm39)	I2002M	probably damaging	Het
Foxp1	A	G	6: 98,922,493 (GRCm39)		probably null	Het
Fut8	A	G	12: 77,411,983 (GRCm39)	D111G	probably benign	Het
Golgb1	C	T	16: 36,719,051 (GRCm39)	A319V	probably benign	Het
Mfng	C	T	15: 78,648,588 (GRCm39)	R163H	probably benign	Het
Or52b1	T	A	7: 104,978,731 (GRCm39)	I223F	probably damaging	Het
Pate8	T	A	9: 36,493,200 (GRCm39)	N41Y	probably benign	Het
Pcdhb2	A	G	18: 37,429,785 (GRCm39)	Y586C	probably damaging	Het
Plcd1	G	A	9: 118,903,519 (GRCm39)	Q442*	probably null	Het
Plppr5	A	G	3: 117,419,552 (GRCm39)	T207A	probably benign	Het
Pomt1	C	A	2: 32,144,341 (GRCm39)	A709E	probably benign	Het
Prmt8	A	G	6: 127,709,677 (GRCm39)	M61T	probably benign	Het
Ptpn23	A	G	9: 110,214,506 (GRCm39)		probably benign	Het
Sbf2	T	A	7: 110,021,747 (GRCm39)	K493*	probably null	Het
Semp2l2a	A	G	8: 13,886,844 (GRCm39)	S416P	possibly damaging	Het
Tmc2	A	T	2: 130,076,738 (GRCm39)	S355C	probably damaging	Het
Tonsl	A	G	15: 76,520,857 (GRCm39)	S399P	possibly damaging	Het
Ttc14	T	C	3: 33,863,050 (GRCm39)		probably benign	Het
Ttn	A	G	2: 76,568,409 (GRCm39)	S19168P	probably damaging	Het
Usp17lb	A	T	7: 104,490,685 (GRCm39)	S80T	probably damaging	Het
Vmn2r96	A	G	17: 18,804,120 (GRCm39)	I457V	possibly damaging	Het
Wdr64	G	T	1: 175,553,979 (GRCm39)	D170Y	probably damaging	Het
Zbtb42	T	C	12: 112,645,948 (GRCm39)	V41A	probably damaging	Het

Other mutations in Hoxd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02636:Hoxd3	APN	2	74,577,298 (GRCm39)	missense	probably benign	0.32
IGL03017:Hoxd3	APN	2	74,577,050 (GRCm39)	missense	possibly damaging	0.68
candide	UTSW	2	74,574,420 (GRCm39)	missense	probably damaging	1.00
compressed	UTSW	2	74,574,650 (GRCm39)	nonsense	probably null
R1977:Hoxd3	UTSW	2	74,574,620 (GRCm39)	missense	possibly damaging	0.94
R2079:Hoxd3	UTSW	2	74,574,610 (GRCm39)	missense	probably damaging	0.97
R2124:Hoxd3	UTSW	2	74,574,578 (GRCm39)	missense	possibly damaging	0.92
R5250:Hoxd3	UTSW	2	74,574,650 (GRCm39)	nonsense	probably null
R5256:Hoxd3	UTSW	2	74,577,211 (GRCm39)	missense	possibly damaging	0.88
R5943:Hoxd3	UTSW	2	74,577,173 (GRCm39)	missense	probably benign	0.00
R6300:Hoxd3	UTSW	2	74,574,420 (GRCm39)	missense	probably damaging	1.00
R7362:Hoxd3	UTSW	2	74,574,563 (GRCm39)	missense	possibly damaging	0.59
R9203:Hoxd3	UTSW	2	74,576,744 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTACAGGTGCGACTGACAGGTAG -3'
(R):5'- AATGCAGGATGCCCTTAGCC -3'

Sequencing Primer
(F):5'- ACTGACAGGTAGGCCCAG -3'
(R):5'- AGGATGCCCTTAGCCTTCTGG -3'

Posted On

2016-06-21