Incidental Mutation 'R0452:Uhmk1'
ID39651
Institutional Source Beutler Lab
Gene Symbol Uhmk1
Ensembl Gene ENSMUSG00000026667
Gene NameU2AF homology motif (UHM) kinase 1
SynonymsC820018A03Rik, Kist, OTTMUSG00000021542, KIS
MMRRC Submission 038652-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.774) question?
Stock #R0452 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location170193420-170215397 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 170212402 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 132 (M132T)
Ref Sequence ENSEMBL: ENSMUSP00000120787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027979] [ENSMUST00000123399] [ENSMUST00000150821]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027979
AA Change: M132T

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027979
Gene: ENSMUSG00000026667
AA Change: M132T

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 23 298 4.1e-22 PFAM
Pfam:Pkinase 23 304 1.3e-40 PFAM
Pfam:Kdo 65 187 2.6e-7 PFAM
RRM 320 402 2.47e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000123399
AA Change: M132T

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120787
Gene: ENSMUSG00000026667
AA Change: M132T

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 23 299 1.8e-22 PFAM
Pfam:Pkinase 23 304 4.6e-43 PFAM
low complexity region 325 341 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000150821
AA Change: M43T

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115622
Gene: ENSMUSG00000026667
AA Change: M43T

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 210 7e-16 PFAM
Pfam:Pkinase 2 215 1.2e-34 PFAM
RRM 231 313 2.47e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159201
SMART Domains Protein: ENSMUSP00000125148
Gene: ENSMUSG00000044306

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
low complexity region 114 132 N/A INTRINSIC
low complexity region 145 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194988
Meta Mutation Damage Score 0.1217 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a serine/threonine protein kinase that promotes cell cycle progression through G1 by phosphorylation of the cyclin-dependent kinase inhibitor 1B (p27Kip1), which causes nuclear export and degradation. The encoded protein is also thought to function in the adult nervous system and the gene has been associated with schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Mice with disruptions in this gene show accelerated development of neointima after arterial injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030452D12Rik A G 8: 106,507,190 probably benign Het
Acap3 C A 4: 155,902,328 S347* probably null Het
Acvr1 G A 2: 58,500,495 P19L probably benign Het
Add2 G T 6: 86,104,629 E366* probably null Het
Ankrd28 C A 14: 31,748,738 A153S probably damaging Het
Anxa8 A T 14: 34,094,770 I206F probably damaging Het
Arhgef4 G A 1: 34,732,322 E1237K probably damaging Het
Arid1a C T 4: 133,689,105 A1120T unknown Het
Atad5 T C 11: 80,106,421 V857A probably damaging Het
Atp2a3 T A 11: 72,977,232 probably null Het
Atxn1l C T 8: 109,732,395 V412I possibly damaging Het
Card11 A G 5: 140,880,370 S923P probably benign Het
Cars C A 7: 143,592,625 E21* probably null Het
Ccdc115 A G 1: 34,437,621 probably benign Het
Ccnj T A 19: 40,845,064 probably null Het
Cds2 C T 2: 132,298,479 T182I probably damaging Het
Ceacam14 A G 7: 17,815,323 H213R probably benign Het
Cfap44 A T 16: 44,431,945 M806L probably benign Het
Chd8 A T 14: 52,214,587 I1317K probably damaging Het
Cherp A T 8: 72,461,522 probably benign Het
Creb5 C G 6: 53,604,542 T30S possibly damaging Het
Csf2ra A G 19: 61,226,895 M94T probably benign Het
Cyp2b19 A C 7: 26,766,762 D330A probably benign Het
Ddost G A 4: 138,310,188 V188M possibly damaging Het
Dnah7a A T 1: 53,605,819 D1019E probably benign Het
Dtx1 A T 5: 120,694,992 I127N possibly damaging Het
Dyrk2 T C 10: 118,868,763 T3A possibly damaging Het
Elovl5 C T 9: 77,960,911 T35M probably damaging Het
Emc7 T C 2: 112,466,969 probably benign Het
Erp27 T C 6: 136,909,489 Y182C probably damaging Het
Exoc2 T A 13: 30,886,327 probably benign Het
F5 A C 1: 164,185,107 D530A probably damaging Het
Fam149a A T 8: 45,355,649 V149E probably damaging Het
Fbxo41 A G 6: 85,478,182 S614P probably damaging Het
Fmn1 T A 2: 113,636,779 Y1342N possibly damaging Het
Gm10334 A G 6: 41,445,337 Y45H probably benign Het
Gpr22 T A 12: 31,708,794 D443V possibly damaging Het
Il17rd T A 14: 27,091,931 W56R probably damaging Het
Itga2b A T 11: 102,465,953 probably null Het
Jmjd1c T C 10: 67,255,482 M2514T probably benign Het
Klk9 T C 7: 43,794,251 probably benign Het
Krr1 T C 10: 111,975,598 Y66H probably damaging Het
Lamb2 T C 9: 108,486,354 probably benign Het
Lgals3bp A T 11: 118,393,464 Y430N probably benign Het
Lrp10 T C 14: 54,467,579 V113A probably benign Het
Mgam A G 6: 40,759,090 Y841C probably damaging Het
Nisch T A 14: 31,177,464 probably benign Het
Nlrp4d G A 7: 10,378,292 T650I probably benign Het
Olfr1314 T A 2: 112,092,636 K22* probably null Het
Olfr506 C T 7: 108,612,370 T21I possibly damaging Het
Parp4 A G 14: 56,648,843 D1793G unknown Het
Pcm1 A G 8: 41,325,905 D1850G probably benign Het
Pgap2 G A 7: 102,236,462 A145T probably damaging Het
Phc1 G A 6: 122,323,036 A583V probably damaging Het
Plcd3 G A 11: 103,071,259 probably benign Het
Ppm1m T A 9: 106,197,302 Q214L probably damaging Het
Prkg2 A G 5: 98,997,520 probably benign Het
Rasal3 T C 17: 32,395,817 probably benign Het
Rfc1 A T 5: 65,264,297 D1086E probably benign Het
Rnf145 T A 11: 44,561,760 L522H probably damaging Het
Setd2 T A 9: 110,553,100 probably null Het
Sik1 C A 17: 31,849,081 V377F possibly damaging Het
Slc44a4 T C 17: 34,928,095 I367T possibly damaging Het
Slfn3 A G 11: 83,213,128 D275G possibly damaging Het
Smarcad1 A T 6: 65,074,822 N313I possibly damaging Het
Smc4 A T 3: 69,008,028 K138* probably null Het
Smg6 T A 11: 74,930,213 S437T probably benign Het
Spaca9 G T 2: 28,695,993 Q20K probably damaging Het
Spatc1 T G 15: 76,268,293 I41S probably damaging Het
Spink5 A T 18: 43,963,318 T5S possibly damaging Het
St3gal1 C A 15: 67,109,655 probably benign Het
Stat5a C A 11: 100,863,135 T97K probably benign Het
Stat5b A T 11: 100,798,330 I246N probably benign Het
Supt6 G T 11: 78,227,003 D462E probably damaging Het
Swi5 A T 2: 32,281,824 probably benign Het
Syne1 A T 10: 5,405,435 V375E probably damaging Het
Tcp1 T C 17: 12,924,352 F516S probably benign Het
Tdrd7 A T 4: 45,965,488 probably benign Het
Tgfbr3 A T 5: 107,140,423 N457K probably benign Het
Tmem209 A G 6: 30,487,381 M500T probably damaging Het
Tmem44 C T 16: 30,517,463 probably benign Het
Ttc21a T A 9: 119,939,154 probably benign Het
Ttn T A 2: 76,836,003 I88F possibly damaging Het
Ttn A G 2: 76,871,110 probably benign Het
Ube2w T C 1: 16,602,255 probably benign Het
Ufc1 C T 1: 171,289,954 probably benign Het
Usp29 A G 7: 6,963,182 N675D possibly damaging Het
Vmn1r23 A G 6: 57,926,484 V103A possibly damaging Het
Wdr59 G T 8: 111,521,972 R4S possibly damaging Het
Zc3hav1 T A 6: 38,307,437 E914D probably benign Het
Other mutations in Uhmk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Uhmk1 APN 1 170207113 critical splice donor site probably null
IGL02451:Uhmk1 APN 1 170212526 missense possibly damaging 0.89
R0507:Uhmk1 UTSW 1 170207191 missense probably damaging 1.00
R1466:Uhmk1 UTSW 1 170208653 critical splice donor site probably null
R1466:Uhmk1 UTSW 1 170208653 critical splice donor site probably null
R1584:Uhmk1 UTSW 1 170208653 critical splice donor site probably null
R1676:Uhmk1 UTSW 1 170200012 missense probably damaging 1.00
R1806:Uhmk1 UTSW 1 170211059 missense probably damaging 0.98
R2039:Uhmk1 UTSW 1 170212267 missense probably damaging 1.00
R4567:Uhmk1 UTSW 1 170205117 nonsense probably null
R4658:Uhmk1 UTSW 1 170207205 missense probably damaging 1.00
R4765:Uhmk1 UTSW 1 170199901 missense probably damaging 1.00
R5186:Uhmk1 UTSW 1 170211167 missense probably damaging 1.00
R5686:Uhmk1 UTSW 1 170211218 missense probably damaging 1.00
R6210:Uhmk1 UTSW 1 170212237 missense probably damaging 1.00
R6238:Uhmk1 UTSW 1 170199994 missense probably damaging 0.99
R6253:Uhmk1 UTSW 1 170199880 missense probably damaging 1.00
R6682:Uhmk1 UTSW 1 170212235 critical splice donor site probably null
R7522:Uhmk1 UTSW 1 170215240 start codon destroyed probably benign 0.00
R7582:Uhmk1 UTSW 1 170200001 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGTCAGTCCCTAAATTACCATTGGTT -3'
(R):5'- AGAGACAGTGCTAAGTCTGCCTAGAG -3'

Sequencing Primer
(F):5'- ttagaaacccgcctgcc -3'
(R):5'- tcactgaggcactgtattaagg -3'
Posted On2013-05-23