Incidental Mutation 'R5143:Tmc2'
ID396510
Institutional Source Beutler Lab
Gene Symbol Tmc2
Ensembl Gene ENSMUSG00000060332
Gene Nametransmembrane channel-like gene family 2
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R5143 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location130195194-130264445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130234818 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 355 (S355C)
Ref Sequence ENSEMBL: ENSMUSP00000125843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077988] [ENSMUST00000166774]
Predicted Effect probably damaging
Transcript: ENSMUST00000077988
AA Change: S355C

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077139
Gene: ENSMUSG00000060332
AA Change: S355C

DomainStartEndE-ValueType
transmembrane domain 236 258 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 412 434 N/A INTRINSIC
transmembrane domain 488 507 N/A INTRINSIC
low complexity region 541 553 N/A INTRINSIC
Pfam:TMC 556 671 8.6e-41 PFAM
transmembrane domain 676 698 N/A INTRINSIC
transmembrane domain 735 757 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166774
AA Change: S355C

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125843
Gene: ENSMUSG00000060332
AA Change: S355C

DomainStartEndE-ValueType
transmembrane domain 236 258 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 412 434 N/A INTRINSIC
transmembrane domain 488 507 N/A INTRINSIC
low complexity region 541 553 N/A INTRINSIC
Pfam:TMC 556 671 1.2e-36 PFAM
transmembrane domain 676 698 N/A INTRINSIC
transmembrane domain 735 757 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is necesssary for mechanotransduction in cochlear hair cells of the inner ear. Mutations in this gene may underlie hereditary disorders of balance and hearing. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele display normal hearing and motor behavior. Cochlear hair cells show partial resistance to gentamicin induced toxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,739,198 probably null Het
Abcc2 T C 19: 43,821,661 I886T probably benign Het
Adrb2 T C 18: 62,178,776 Y326C probably damaging Het
AF366264 A G 8: 13,836,844 S416P possibly damaging Het
Aplp1 G A 7: 30,441,123 R334C probably damaging Het
AY358078 T C 14: 51,802,549 S39P unknown Het
Bpifb2 A T 2: 153,878,504 D61V probably damaging Het
Caap1 A T 4: 94,501,382 N238K probably damaging Het
Cfap54 A G 10: 93,029,158 V726A possibly damaging Het
Chrna7 T C 7: 63,106,147 Y217C probably damaging Het
Crocc T A 4: 141,041,039 T414S probably benign Het
Cyp2a12 A G 7: 27,036,611 I482V probably benign Het
Dnah6 A T 6: 73,181,761 F620I possibly damaging Het
Eogt A G 6: 97,125,584 L256P probably damaging Het
F5 A G 1: 164,211,828 I2002M probably damaging Het
Foxp1 A G 6: 98,945,532 probably null Het
Fut8 A G 12: 77,365,209 D111G probably benign Het
Gm17689 T A 9: 36,581,904 N41Y probably benign Het
Golgb1 C T 16: 36,898,689 A319V probably benign Het
Hoxd3 C T 2: 74,746,372 R39C probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Olfr690 T A 7: 105,329,524 I223F probably damaging Het
Pcdhb2 A G 18: 37,296,732 Y586C probably damaging Het
Plcd1 G A 9: 119,074,451 Q442* probably null Het
Plppr5 A G 3: 117,625,903 T207A probably benign Het
Pomt1 C A 2: 32,254,329 A709E probably benign Het
Prmt8 A G 6: 127,732,714 M61T probably benign Het
Ptpn23 A G 9: 110,385,438 probably benign Het
Sbf2 T A 7: 110,422,540 K493* probably null Het
Tonsl A G 15: 76,636,657 S399P possibly damaging Het
Ttc14 T C 3: 33,808,901 probably benign Het
Ttn A G 2: 76,738,065 S19168P probably damaging Het
Usp17lb A T 7: 104,841,478 S80T probably damaging Het
Vmn2r96 A G 17: 18,583,858 I457V possibly damaging Het
Wdr64 G T 1: 175,726,413 D170Y probably damaging Het
Zbtb42 T C 12: 112,679,514 V41A probably damaging Het
Other mutations in Tmc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Tmc2 APN 2 130261304 missense possibly damaging 0.94
IGL00966:Tmc2 APN 2 130264012 missense probably benign 0.02
IGL01094:Tmc2 APN 2 130260166 splice site probably benign
IGL01331:Tmc2 APN 2 130232356 missense probably damaging 1.00
IGL01660:Tmc2 APN 2 130260224 nonsense probably null
IGL01926:Tmc2 APN 2 130260240 missense possibly damaging 0.68
IGL02150:Tmc2 APN 2 130240153 missense probably damaging 0.98
IGL02273:Tmc2 APN 2 130229206 missense probably damaging 0.99
IGL03137:Tmc2 APN 2 130240130 missense probably damaging 1.00
IGL03179:Tmc2 APN 2 130229187 missense probably damaging 1.00
FR4449:Tmc2 UTSW 2 130240196 missense probably damaging 1.00
H8786:Tmc2 UTSW 2 130226262 missense probably damaging 1.00
PIT4418001:Tmc2 UTSW 2 130248651 missense probably damaging 0.96
R0364:Tmc2 UTSW 2 130202103 missense probably benign 0.00
R1183:Tmc2 UTSW 2 130247976 missense probably damaging 1.00
R1446:Tmc2 UTSW 2 130248730 missense probably damaging 0.97
R1458:Tmc2 UTSW 2 130248762 missense probably damaging 1.00
R1589:Tmc2 UTSW 2 130247960 missense probably damaging 0.99
R1656:Tmc2 UTSW 2 130247934 missense possibly damaging 0.93
R1686:Tmc2 UTSW 2 130256116 missense possibly damaging 0.71
R1765:Tmc2 UTSW 2 130260225 missense probably benign 0.34
R1776:Tmc2 UTSW 2 130234869 missense probably damaging 1.00
R1873:Tmc2 UTSW 2 130248756 missense possibly damaging 0.68
R1972:Tmc2 UTSW 2 130214664 splice site probably benign
R2020:Tmc2 UTSW 2 130232385 missense probably damaging 1.00
R2208:Tmc2 UTSW 2 130214563 splice site probably null
R3968:Tmc2 UTSW 2 130202071 missense probably benign 0.02
R4732:Tmc2 UTSW 2 130261397 splice site probably null
R4733:Tmc2 UTSW 2 130261397 splice site probably null
R4989:Tmc2 UTSW 2 130202041 missense possibly damaging 0.88
R5411:Tmc2 UTSW 2 130240115 missense probably damaging 1.00
R5514:Tmc2 UTSW 2 130241644 missense possibly damaging 0.94
R5690:Tmc2 UTSW 2 130232386 missense probably damaging 1.00
R5983:Tmc2 UTSW 2 130247976 missense probably damaging 1.00
R6451:Tmc2 UTSW 2 130264203 missense probably damaging 0.99
R6927:Tmc2 UTSW 2 130261380 missense probably benign
R7132:Tmc2 UTSW 2 130232409 missense possibly damaging 0.82
R7240:Tmc2 UTSW 2 130234804 missense possibly damaging 0.80
R7353:Tmc2 UTSW 2 130196577 critical splice donor site probably null
X0019:Tmc2 UTSW 2 130208285 missense possibly damaging 0.59
X0052:Tmc2 UTSW 2 130201972 missense probably benign 0.00
Z1177:Tmc2 UTSW 2 130208296 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TGACATCTGGGTACTCATAGGTAAC -3'
(R):5'- AAGCTTCCCAGTGGCTAGAG -3'

Sequencing Primer
(F):5'- AATTGACCTAACTAATGTCCCTCC -3'
(R):5'- CTAGAGGGACCCAGAGTTTTCTC -3'
Posted On2016-06-21