Mutagenetix > Incidental Mutation

Incidental Mutation 'R5143:Tmc2'

396510

Institutional Source

Beutler Lab

Gene Symbol

Tmc2

Ensembl Gene

ENSMUSG00000060332

Gene Name

transmembrane channel-like gene family 2

Synonyms

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.244) question?

Stock #

R5143 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

130195194-130264445 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 130234818 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 355 (S355C)

Ref Sequence

ENSEMBL: ENSMUSP00000125843 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077988] [ENSMUST00000166774]

AlphaFold

Q8R4P4

Predicted Effect

probably damaging
Transcript: ENSMUST00000077988
AA Change: S355C

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000077139
Gene: ENSMUSG00000060332
AA Change: S355C

Domain	Start	End	E-Value	Type
transmembrane domain	236	258	N/A	INTRINSIC
transmembrane domain	317	339	N/A	INTRINSIC
transmembrane domain	412	434	N/A	INTRINSIC
transmembrane domain	488	507	N/A	INTRINSIC
low complexity region	541	553	N/A	INTRINSIC
Pfam:TMC	556	671	8.6e-41	PFAM
transmembrane domain	676	698	N/A	INTRINSIC
transmembrane domain	735	757	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166774
AA Change: S355C

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000125843
Gene: ENSMUSG00000060332
AA Change: S355C

Domain	Start	End	E-Value	Type
transmembrane domain	236	258	N/A	INTRINSIC
transmembrane domain	317	339	N/A	INTRINSIC
transmembrane domain	412	434	N/A	INTRINSIC
transmembrane domain	488	507	N/A	INTRINSIC
low complexity region	541	553	N/A	INTRINSIC
Pfam:TMC	556	671	1.2e-36	PFAM
transmembrane domain	676	698	N/A	INTRINSIC
transmembrane domain	735	757	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is necesssary for mechanotransduction in cochlear hair cells of the inner ear. Mutations in this gene may underlie hereditary disorders of balance and hearing. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele display normal hearing and motor behavior. Cochlear hair cells show partial resistance to gentamicin induced toxicity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	C	T	5: 109,739,198		probably null	Het
Abcc2	T	C	19: 43,821,661	I886T	probably benign	Het
Adrb2	T	C	18: 62,178,776	Y326C	probably damaging	Het
AF366264	A	G	8: 13,836,844	S416P	possibly damaging	Het
Aplp1	G	A	7: 30,441,123	R334C	probably damaging	Het
AY358078	T	C	14: 51,802,549	S39P	unknown	Het
Bpifb2	A	T	2: 153,878,504	D61V	probably damaging	Het
Caap1	A	T	4: 94,501,382	N238K	probably damaging	Het
Cfap54	A	G	10: 93,029,158	V726A	possibly damaging	Het
Chrna7	T	C	7: 63,106,147	Y217C	probably damaging	Het
Crocc	T	A	4: 141,041,039	T414S	probably benign	Het
Cyp2a12	A	G	7: 27,036,611	I482V	probably benign	Het
Dnah6	A	T	6: 73,181,761	F620I	possibly damaging	Het
Eogt	A	G	6: 97,125,584	L256P	probably damaging	Het
F5	A	G	1: 164,211,828	I2002M	probably damaging	Het
Foxp1	A	G	6: 98,945,532		probably null	Het
Fut8	A	G	12: 77,365,209	D111G	probably benign	Het
Gm17689	T	A	9: 36,581,904	N41Y	probably benign	Het
Golgb1	C	T	16: 36,898,689	A319V	probably benign	Het
Hoxd3	C	T	2: 74,746,372	R39C	probably damaging	Het
Mfng	C	T	15: 78,764,388	R163H	probably benign	Het
Olfr690	T	A	7: 105,329,524	I223F	probably damaging	Het
Pcdhb2	A	G	18: 37,296,732	Y586C	probably damaging	Het
Plcd1	G	A	9: 119,074,451	Q442*	probably null	Het
Plppr5	A	G	3: 117,625,903	T207A	probably benign	Het
Pomt1	C	A	2: 32,254,329	A709E	probably benign	Het
Prmt8	A	G	6: 127,732,714	M61T	probably benign	Het
Ptpn23	A	G	9: 110,385,438		probably benign	Het
Sbf2	T	A	7: 110,422,540	K493*	probably null	Het
Tonsl	A	G	15: 76,636,657	S399P	possibly damaging	Het
Ttc14	T	C	3: 33,808,901		probably benign	Het
Ttn	A	G	2: 76,738,065	S19168P	probably damaging	Het
Usp17lb	A	T	7: 104,841,478	S80T	probably damaging	Het
Vmn2r96	A	G	17: 18,583,858	I457V	possibly damaging	Het
Wdr64	G	T	1: 175,726,413	D170Y	probably damaging	Het
Zbtb42	T	C	12: 112,679,514	V41A	probably damaging	Het

Other mutations in Tmc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Tmc2	APN	2	130261304	missense	possibly damaging	0.94
IGL00966:Tmc2	APN	2	130264012	missense	probably benign	0.02
IGL01094:Tmc2	APN	2	130260166	splice site	probably benign
IGL01331:Tmc2	APN	2	130232356	missense	probably damaging	1.00
IGL01660:Tmc2	APN	2	130260224	nonsense	probably null
IGL01926:Tmc2	APN	2	130260240	missense	possibly damaging	0.68
IGL02150:Tmc2	APN	2	130240153	missense	probably damaging	0.98
IGL02273:Tmc2	APN	2	130229206	missense	probably damaging	0.99
IGL03137:Tmc2	APN	2	130240130	missense	probably damaging	1.00
IGL03179:Tmc2	APN	2	130229187	missense	probably damaging	1.00
FR4449:Tmc2	UTSW	2	130240196	missense	probably damaging	1.00
H8786:Tmc2	UTSW	2	130226262	missense	probably damaging	1.00
PIT4418001:Tmc2	UTSW	2	130248651	missense	probably damaging	0.96
R0364:Tmc2	UTSW	2	130202103	missense	probably benign	0.00
R1183:Tmc2	UTSW	2	130247976	missense	probably damaging	1.00
R1446:Tmc2	UTSW	2	130248730	missense	probably damaging	0.97
R1458:Tmc2	UTSW	2	130248762	missense	probably damaging	1.00
R1589:Tmc2	UTSW	2	130247960	missense	probably damaging	0.99
R1656:Tmc2	UTSW	2	130247934	missense	possibly damaging	0.93
R1686:Tmc2	UTSW	2	130256116	missense	possibly damaging	0.71
R1765:Tmc2	UTSW	2	130260225	missense	probably benign	0.34
R1776:Tmc2	UTSW	2	130234869	missense	probably damaging	1.00
R1873:Tmc2	UTSW	2	130248756	missense	possibly damaging	0.68
R1972:Tmc2	UTSW	2	130214664	splice site	probably benign
R2020:Tmc2	UTSW	2	130232385	missense	probably damaging	1.00
R2208:Tmc2	UTSW	2	130214563	splice site	probably null
R3968:Tmc2	UTSW	2	130202071	missense	probably benign	0.02
R4732:Tmc2	UTSW	2	130261397	splice site	probably null
R4733:Tmc2	UTSW	2	130261397	splice site	probably null
R4989:Tmc2	UTSW	2	130202041	missense	possibly damaging	0.88
R5411:Tmc2	UTSW	2	130240115	missense	probably damaging	1.00
R5514:Tmc2	UTSW	2	130241644	missense	possibly damaging	0.94
R5690:Tmc2	UTSW	2	130232386	missense	probably damaging	1.00
R5983:Tmc2	UTSW	2	130247976	missense	probably damaging	1.00
R6451:Tmc2	UTSW	2	130264203	missense	probably damaging	0.99
R6927:Tmc2	UTSW	2	130261380	missense	probably benign
R7132:Tmc2	UTSW	2	130232409	missense	possibly damaging	0.82
R7240:Tmc2	UTSW	2	130234804	missense	possibly damaging	0.80
R7353:Tmc2	UTSW	2	130196577	critical splice donor site	probably null
R8167:Tmc2	UTSW	2	130241568	missense	probably benign	0.04
R8554:Tmc2	UTSW	2	130264164	missense	probably benign	0.00
R9134:Tmc2	UTSW	2	130232401	missense	probably benign	0.21
R9169:Tmc2	UTSW	2	130241596	missense	probably damaging	1.00
R9209:Tmc2	UTSW	2	130261397	splice site	probably null
R9232:Tmc2	UTSW	2	130243129	missense	probably damaging	1.00
R9725:Tmc2	UTSW	2	130247961	missense	probably damaging	0.99
X0019:Tmc2	UTSW	2	130208285	missense	possibly damaging	0.59
X0052:Tmc2	UTSW	2	130201972	missense	probably benign	0.00
Z1177:Tmc2	UTSW	2	130208296	missense	possibly damaging	0.56

Predicted Primers

PCR Primer
(F):5'- TGACATCTGGGTACTCATAGGTAAC -3'
(R):5'- AAGCTTCCCAGTGGCTAGAG -3'

Sequencing Primer
(F):5'- AATTGACCTAACTAATGTCCCTCC -3'
(R):5'- CTAGAGGGACCCAGAGTTTTCTC -3'

Posted On

2016-06-21