Incidental Mutation 'R5143:Ttc14'
ID396512
Institutional Source Beutler Lab
Gene Symbol Ttc14
Ensembl Gene ENSMUSG00000027677
Gene Nametetratricopeptide repeat domain 14
SynonymscI-44, 2700016E08Rik, 4930434D01Rik, 4931403I22Rik, 4933402I15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R5143 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location33799832-33814860 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 33808901 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029222] [ENSMUST00000099153] [ENSMUST00000108210] [ENSMUST00000117915] [ENSMUST00000196369] [ENSMUST00000196975] [ENSMUST00000198529] [ENSMUST00000199222] [ENSMUST00000200271]
Predicted Effect probably benign
Transcript: ENSMUST00000029222
SMART Domains Protein: ENSMUSP00000029222
Gene: ENSMUSG00000027676

DomainStartEndE-ValueType
coiled coil region 16 67 N/A INTRINSIC
coiled coil region 164 198 N/A INTRINSIC
coiled coil region 232 339 N/A INTRINSIC
low complexity region 381 393 N/A INTRINSIC
internal_repeat_1 569 603 1.19e-5 PROSPERO
internal_repeat_1 598 635 1.19e-5 PROSPERO
coiled coil region 664 704 N/A INTRINSIC
coiled coil region 726 766 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
low complexity region 915 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099153
SMART Domains Protein: ENSMUSP00000096757
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 306 339 6.19e-1 SMART
TPR 340 373 2.11e-3 SMART
TPR 381 414 1.88e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000108210
AA Change: V538A
SMART Domains Protein: ENSMUSP00000103845
Gene: ENSMUSG00000027677
AA Change: V538A

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 306 339 6.19e-1 SMART
TPR 340 373 2.11e-3 SMART
TPR 381 414 1.88e0 SMART
coiled coil region 415 476 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000117915
AA Change: V486A
SMART Domains Protein: ENSMUSP00000112450
Gene: ENSMUSG00000027677
AA Change: V486A

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 254 287 6.19e-1 SMART
TPR 288 321 2.11e-3 SMART
TPR 329 362 1.88e0 SMART
coiled coil region 363 424 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196369
SMART Domains Protein: ENSMUSP00000142863
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
S1 21 105 7.28e-2 SMART
TPR 204 237 6.19e-1 SMART
TPR 238 271 2.11e-3 SMART
TPR 279 312 1.88e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196975
SMART Domains Protein: ENSMUSP00000142684
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 4.6e-4 SMART
TPR 254 287 3e-3 SMART
TPR 288 321 1e-5 SMART
TPR 329 362 9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198529
SMART Domains Protein: ENSMUSP00000143073
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
Pfam:TPR_11 304 371 2.1e-12 PFAM
Pfam:TPR_2 306 339 1.9e-4 PFAM
Pfam:TPR_1 308 339 1.3e-4 PFAM
Pfam:TPR_1 340 373 2.9e-5 PFAM
Pfam:TPR_2 340 373 6.8e-4 PFAM
low complexity region 395 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199222
SMART Domains Protein: ENSMUSP00000142935
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 306 339 6.19e-1 SMART
TPR 340 373 2.11e-3 SMART
TPR 381 414 1.88e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200271
SMART Domains Protein: ENSMUSP00000143738
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
S1 120 204 7.28e-2 SMART
TPR 303 336 6.19e-1 SMART
TPR 337 370 2.11e-3 SMART
TPR 378 411 1.88e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200536
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,739,198 probably null Het
Abcc2 T C 19: 43,821,661 I886T probably benign Het
Adrb2 T C 18: 62,178,776 Y326C probably damaging Het
AF366264 A G 8: 13,836,844 S416P possibly damaging Het
Aplp1 G A 7: 30,441,123 R334C probably damaging Het
AY358078 T C 14: 51,802,549 S39P unknown Het
Bpifb2 A T 2: 153,878,504 D61V probably damaging Het
Caap1 A T 4: 94,501,382 N238K probably damaging Het
Cfap54 A G 10: 93,029,158 V726A possibly damaging Het
Chrna7 T C 7: 63,106,147 Y217C probably damaging Het
Crocc T A 4: 141,041,039 T414S probably benign Het
Cyp2a12 A G 7: 27,036,611 I482V probably benign Het
Dnah6 A T 6: 73,181,761 F620I possibly damaging Het
Eogt A G 6: 97,125,584 L256P probably damaging Het
F5 A G 1: 164,211,828 I2002M probably damaging Het
Foxp1 A G 6: 98,945,532 probably null Het
Fut8 A G 12: 77,365,209 D111G probably benign Het
Gm17689 T A 9: 36,581,904 N41Y probably benign Het
Golgb1 C T 16: 36,898,689 A319V probably benign Het
Hoxd3 C T 2: 74,746,372 R39C probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Olfr690 T A 7: 105,329,524 I223F probably damaging Het
Pcdhb2 A G 18: 37,296,732 Y586C probably damaging Het
Plcd1 G A 9: 119,074,451 Q442* probably null Het
Plppr5 A G 3: 117,625,903 T207A probably benign Het
Pomt1 C A 2: 32,254,329 A709E probably benign Het
Prmt8 A G 6: 127,732,714 M61T probably benign Het
Ptpn23 A G 9: 110,385,438 probably benign Het
Sbf2 T A 7: 110,422,540 K493* probably null Het
Tmc2 A T 2: 130,234,818 S355C probably damaging Het
Tonsl A G 15: 76,636,657 S399P possibly damaging Het
Ttn A G 2: 76,738,065 S19168P probably damaging Het
Usp17lb A T 7: 104,841,478 S80T probably damaging Het
Vmn2r96 A G 17: 18,583,858 I457V possibly damaging Het
Wdr64 G T 1: 175,726,413 D170Y probably damaging Het
Zbtb42 T C 12: 112,679,514 V41A probably damaging Het
Other mutations in Ttc14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Ttc14 APN 3 33803099 missense probably benign 0.35
IGL01326:Ttc14 APN 3 33801358 missense probably benign 0.14
R0196:Ttc14 UTSW 3 33809254 unclassified probably benign
R0427:Ttc14 UTSW 3 33803484 missense probably damaging 1.00
R1713:Ttc14 UTSW 3 33802920 missense probably damaging 1.00
R2312:Ttc14 UTSW 3 33807835 splice site probably null
R2434:Ttc14 UTSW 3 33801078 missense probably benign 0.40
R4794:Ttc14 UTSW 3 33803149 missense probably benign 0.00
R4825:Ttc14 UTSW 3 33801369 missense possibly damaging 0.88
R4888:Ttc14 UTSW 3 33806875 nonsense probably null
R6051:Ttc14 UTSW 3 33808924 unclassified probably benign
R6270:Ttc14 UTSW 3 33800388 missense possibly damaging 0.68
R6415:Ttc14 UTSW 3 33803575 missense possibly damaging 0.81
R6439:Ttc14 UTSW 3 33808819 unclassified probably benign
R7021:Ttc14 UTSW 3 33803497 missense probably damaging 0.99
R7571:Ttc14 UTSW 3 33809251 missense unknown
R7751:Ttc14 UTSW 3 33809441 missense unknown
R8021:Ttc14 UTSW 3 33809121 nonsense probably null
R8388:Ttc14 UTSW 3 33800586 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACGTGTCTGATGAGCCAAC -3'
(R):5'- ACCTGCCTGGGTTTTATAGCTATTG -3'

Sequencing Primer
(F):5'- TCAAGTGTTTCTTCTGCTGATGAATC -3'
(R):5'- TATTGTAAAAATCTGACCTACCTCCC -3'
Posted On2016-06-21