Incidental Mutation 'R5143:Caap1'
ID396513
Institutional Source Beutler Lab
Gene Symbol Caap1
Ensembl Gene ENSMUSG00000028578
Gene Namecaspase activity and apoptosis inhibitor 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R5143 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location94500081-94556796 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94501382 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 238 (N238K)
Ref Sequence ENSEMBL: ENSMUSP00000030313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030313]
Predicted Effect probably damaging
Transcript: ENSMUST00000030313
AA Change: N238K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030313
Gene: ENSMUSG00000028578
AA Change: N238K

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
low complexity region 33 58 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
Pfam:CAAP1 113 175 3.2e-31 PFAM
low complexity region 254 271 N/A INTRINSIC
coiled coil region 276 303 N/A INTRINSIC
low complexity region 331 337 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118149
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,739,198 probably null Het
Abcc2 T C 19: 43,821,661 I886T probably benign Het
Adrb2 T C 18: 62,178,776 Y326C probably damaging Het
AF366264 A G 8: 13,836,844 S416P possibly damaging Het
Aplp1 G A 7: 30,441,123 R334C probably damaging Het
AY358078 T C 14: 51,802,549 S39P unknown Het
Bpifb2 A T 2: 153,878,504 D61V probably damaging Het
Cfap54 A G 10: 93,029,158 V726A possibly damaging Het
Chrna7 T C 7: 63,106,147 Y217C probably damaging Het
Crocc T A 4: 141,041,039 T414S probably benign Het
Cyp2a12 A G 7: 27,036,611 I482V probably benign Het
Dnah6 A T 6: 73,181,761 F620I possibly damaging Het
Eogt A G 6: 97,125,584 L256P probably damaging Het
F5 A G 1: 164,211,828 I2002M probably damaging Het
Foxp1 A G 6: 98,945,532 probably null Het
Fut8 A G 12: 77,365,209 D111G probably benign Het
Gm17689 T A 9: 36,581,904 N41Y probably benign Het
Golgb1 C T 16: 36,898,689 A319V probably benign Het
Hoxd3 C T 2: 74,746,372 R39C probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Olfr690 T A 7: 105,329,524 I223F probably damaging Het
Pcdhb2 A G 18: 37,296,732 Y586C probably damaging Het
Plcd1 G A 9: 119,074,451 Q442* probably null Het
Plppr5 A G 3: 117,625,903 T207A probably benign Het
Pomt1 C A 2: 32,254,329 A709E probably benign Het
Prmt8 A G 6: 127,732,714 M61T probably benign Het
Ptpn23 A G 9: 110,385,438 probably benign Het
Sbf2 T A 7: 110,422,540 K493* probably null Het
Tmc2 A T 2: 130,234,818 S355C probably damaging Het
Tonsl A G 15: 76,636,657 S399P possibly damaging Het
Ttc14 T C 3: 33,808,901 probably benign Het
Ttn A G 2: 76,738,065 S19168P probably damaging Het
Usp17lb A T 7: 104,841,478 S80T probably damaging Het
Vmn2r96 A G 17: 18,583,858 I457V possibly damaging Het
Wdr64 G T 1: 175,726,413 D170Y probably damaging Het
Zbtb42 T C 12: 112,679,514 V41A probably damaging Het
Other mutations in Caap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02040:Caap1 APN 4 94550430 missense probably damaging 0.98
IGL02542:Caap1 APN 4 94550505 missense probably benign 0.15
IGL03162:Caap1 APN 4 94501024 utr 3 prime probably benign
R0485:Caap1 UTSW 4 94550521 splice site probably null
R1014:Caap1 UTSW 4 94549146 missense probably benign 0.02
R1570:Caap1 UTSW 4 94556577 missense probably benign 0.27
R3726:Caap1 UTSW 4 94501143 missense probably damaging 0.99
R4745:Caap1 UTSW 4 94556514 splice site probably null
R4815:Caap1 UTSW 4 94501260 missense probably benign 0.01
R4970:Caap1 UTSW 4 94521060 critical splice donor site probably null
R5265:Caap1 UTSW 4 94501228 nonsense probably null
R6513:Caap1 UTSW 4 94501403 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCTGCTGGAGGAACAGTCAG -3'
(R):5'- TTCCAGATGAACTTGGGCC -3'

Sequencing Primer
(F):5'- CTTTGGGCTAGACTCTGCCAG -3'
(R):5'- CCAGATGAACTTGGGCCTTTATAG -3'
Posted On2016-06-21