Incidental Mutation 'R5143:Prmt8'
ID396519
Institutional Source Beutler Lab
Gene Symbol Prmt8
Ensembl Gene ENSMUSG00000030350
Gene Nameprotein arginine N-methyltransferase 8
SynonymsHrmt1l3, Hrmt1l4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5143 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location127689011-127769472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127732714 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 61 (M61T)
Ref Sequence ENSEMBL: ENSMUSP00000032500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032500]
Predicted Effect probably benign
Transcript: ENSMUST00000032500
AA Change: M61T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032500
Gene: ENSMUSG00000030350
AA Change: M61T

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:PRMT5 80 368 4.5e-7 PFAM
Pfam:PrmA 102 200 2e-10 PFAM
Pfam:Methyltransf_31 110 274 7.3e-9 PFAM
Pfam:Methyltransf_18 111 215 9.9e-8 PFAM
Pfam:Methyltransf_11 116 215 6.2e-8 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arginine methylation is a widespread posttranslational modification mediated by arginine methyltransferases, such as PRMT8. Arginine methylation is involved in a number of cellular processes, including DNA repair, RNA transcription, signal transduction, protein compartmentalization, and possibly protein translation (Lee et al., 2005 [PubMed 16051612]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knockout allele exhibit abnormal Purkinje cell dendrite morphology, hyperactivity, limb grasping and gait abnormalities, and show reduced levels of acetylcholine and choline along with increased phosphatidylcholine levels in the cerebellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,739,198 probably null Het
Abcc2 T C 19: 43,821,661 I886T probably benign Het
Adrb2 T C 18: 62,178,776 Y326C probably damaging Het
AF366264 A G 8: 13,836,844 S416P possibly damaging Het
Aplp1 G A 7: 30,441,123 R334C probably damaging Het
AY358078 T C 14: 51,802,549 S39P unknown Het
Bpifb2 A T 2: 153,878,504 D61V probably damaging Het
Caap1 A T 4: 94,501,382 N238K probably damaging Het
Cfap54 A G 10: 93,029,158 V726A possibly damaging Het
Chrna7 T C 7: 63,106,147 Y217C probably damaging Het
Crocc T A 4: 141,041,039 T414S probably benign Het
Cyp2a12 A G 7: 27,036,611 I482V probably benign Het
Dnah6 A T 6: 73,181,761 F620I possibly damaging Het
Eogt A G 6: 97,125,584 L256P probably damaging Het
F5 A G 1: 164,211,828 I2002M probably damaging Het
Foxp1 A G 6: 98,945,532 probably null Het
Fut8 A G 12: 77,365,209 D111G probably benign Het
Gm17689 T A 9: 36,581,904 N41Y probably benign Het
Golgb1 C T 16: 36,898,689 A319V probably benign Het
Hoxd3 C T 2: 74,746,372 R39C probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Olfr690 T A 7: 105,329,524 I223F probably damaging Het
Pcdhb2 A G 18: 37,296,732 Y586C probably damaging Het
Plcd1 G A 9: 119,074,451 Q442* probably null Het
Plppr5 A G 3: 117,625,903 T207A probably benign Het
Pomt1 C A 2: 32,254,329 A709E probably benign Het
Ptpn23 A G 9: 110,385,438 probably benign Het
Sbf2 T A 7: 110,422,540 K493* probably null Het
Tmc2 A T 2: 130,234,818 S355C probably damaging Het
Tonsl A G 15: 76,636,657 S399P possibly damaging Het
Ttc14 T C 3: 33,808,901 probably benign Het
Ttn A G 2: 76,738,065 S19168P probably damaging Het
Usp17lb A T 7: 104,841,478 S80T probably damaging Het
Vmn2r96 A G 17: 18,583,858 I457V possibly damaging Het
Wdr64 G T 1: 175,726,413 D170Y probably damaging Het
Zbtb42 T C 12: 112,679,514 V41A probably damaging Het
Other mutations in Prmt8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02122:Prmt8 APN 6 127690717 missense probably benign 0.17
IGL02178:Prmt8 APN 6 127697807 missense probably benign 0.06
IGL02526:Prmt8 APN 6 127711823 missense probably damaging 0.96
IGL03010:Prmt8 APN 6 127729535 missense probably benign 0.09
IGL03037:Prmt8 APN 6 127703977 missense possibly damaging 0.75
R0096:Prmt8 UTSW 6 127732627 splice site probably benign
R0254:Prmt8 UTSW 6 127711808 missense probably damaging 1.00
R0355:Prmt8 UTSW 6 127711874 nonsense probably null
R0925:Prmt8 UTSW 6 127697813 missense probably benign 0.00
R1606:Prmt8 UTSW 6 127689836 nonsense probably null
R1716:Prmt8 UTSW 6 127726523 critical splice donor site probably null
R3789:Prmt8 UTSW 6 127711147 missense probably damaging 1.00
R3790:Prmt8 UTSW 6 127711147 missense probably damaging 1.00
R3958:Prmt8 UTSW 6 127732744 missense probably benign 0.00
R5022:Prmt8 UTSW 6 127711163 missense possibly damaging 0.92
R5635:Prmt8 UTSW 6 127768729 missense probably damaging 1.00
R5816:Prmt8 UTSW 6 127697738 missense probably benign 0.09
R5959:Prmt8 UTSW 6 127729418 missense probably damaging 1.00
R6267:Prmt8 UTSW 6 127711804 missense probably damaging 0.99
R6296:Prmt8 UTSW 6 127711804 missense probably damaging 0.99
R6450:Prmt8 UTSW 6 127732643 missense possibly damaging 0.71
R6603:Prmt8 UTSW 6 127729413 missense probably benign 0.00
R7208:Prmt8 UTSW 6 127689829 missense possibly damaging 0.81
R7629:Prmt8 UTSW 6 127689883 nonsense probably null
R7719:Prmt8 UTSW 6 127729503 missense probably damaging 0.97
R8313:Prmt8 UTSW 6 127689850 missense probably benign
R8346:Prmt8 UTSW 6 127711847 missense probably damaging 1.00
R8404:Prmt8 UTSW 6 127689862 missense possibly damaging 0.93
X0020:Prmt8 UTSW 6 127697771 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTTGGCCATACCTGCTCTG -3'
(R):5'- TAGGCCACTGTCAGTCACATGG -3'

Sequencing Primer
(F):5'- TGCTCTGCCACCTCTACAAAC -3'
(R):5'- CCACTGTCAGTCACATGGTTGAAAAG -3'
Posted On2016-06-21