Incidental Mutation 'R5143:Cyp2a12'
ID396520
Institutional Source Beutler Lab
Gene Symbol Cyp2a12
Ensembl Gene ENSMUSG00000060407
Gene Namecytochrome P450, family 2, subfamily a, polypeptide 12
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5143 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location27029081-27037375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27036611 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 482 (I482V)
Ref Sequence ENSEMBL: ENSMUSP00000074990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075552]
Predicted Effect probably benign
Transcript: ENSMUST00000075552
AA Change: I482V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000074990
Gene: ENSMUSG00000060407
AA Change: I482V

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:p450 33 489 7.3e-153 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207016
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,739,198 probably null Het
Abcc2 T C 19: 43,821,661 I886T probably benign Het
Adrb2 T C 18: 62,178,776 Y326C probably damaging Het
AF366264 A G 8: 13,836,844 S416P possibly damaging Het
Aplp1 G A 7: 30,441,123 R334C probably damaging Het
AY358078 T C 14: 51,802,549 S39P unknown Het
Bpifb2 A T 2: 153,878,504 D61V probably damaging Het
Caap1 A T 4: 94,501,382 N238K probably damaging Het
Cfap54 A G 10: 93,029,158 V726A possibly damaging Het
Chrna7 T C 7: 63,106,147 Y217C probably damaging Het
Crocc T A 4: 141,041,039 T414S probably benign Het
Dnah6 A T 6: 73,181,761 F620I possibly damaging Het
Eogt A G 6: 97,125,584 L256P probably damaging Het
F5 A G 1: 164,211,828 I2002M probably damaging Het
Foxp1 A G 6: 98,945,532 probably null Het
Fut8 A G 12: 77,365,209 D111G probably benign Het
Gm17689 T A 9: 36,581,904 N41Y probably benign Het
Golgb1 C T 16: 36,898,689 A319V probably benign Het
Hoxd3 C T 2: 74,746,372 R39C probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Olfr690 T A 7: 105,329,524 I223F probably damaging Het
Pcdhb2 A G 18: 37,296,732 Y586C probably damaging Het
Plcd1 G A 9: 119,074,451 Q442* probably null Het
Plppr5 A G 3: 117,625,903 T207A probably benign Het
Pomt1 C A 2: 32,254,329 A709E probably benign Het
Prmt8 A G 6: 127,732,714 M61T probably benign Het
Ptpn23 A G 9: 110,385,438 probably benign Het
Sbf2 T A 7: 110,422,540 K493* probably null Het
Tmc2 A T 2: 130,234,818 S355C probably damaging Het
Tonsl A G 15: 76,636,657 S399P possibly damaging Het
Ttc14 T C 3: 33,808,901 probably benign Het
Ttn A G 2: 76,738,065 S19168P probably damaging Het
Usp17lb A T 7: 104,841,478 S80T probably damaging Het
Vmn2r96 A G 17: 18,583,858 I457V possibly damaging Het
Wdr64 G T 1: 175,726,413 D170Y probably damaging Het
Zbtb42 T C 12: 112,679,514 V41A probably damaging Het
Other mutations in Cyp2a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02191:Cyp2a12 APN 7 27036611 missense probably benign 0.00
IGL02306:Cyp2a12 APN 7 27032583 missense probably damaging 1.00
IGL02667:Cyp2a12 APN 7 27031158 missense probably damaging 1.00
IGL02943:Cyp2a12 APN 7 27032542 missense probably benign 0.07
IGL03025:Cyp2a12 APN 7 27031206 missense probably benign 0.00
IGL03230:Cyp2a12 APN 7 27029592 missense possibly damaging 0.48
PIT4243001:Cyp2a12 UTSW 7 27034773 missense probably benign 0.00
PIT4618001:Cyp2a12 UTSW 7 27034773 missense probably benign 0.00
R0655:Cyp2a12 UTSW 7 27036621 missense probably benign 0.15
R0659:Cyp2a12 UTSW 7 27034138 missense probably damaging 1.00
R0743:Cyp2a12 UTSW 7 27032542 missense probably benign 0.07
R0884:Cyp2a12 UTSW 7 27032542 missense probably benign 0.07
R2118:Cyp2a12 UTSW 7 27036646 makesense probably null
R2119:Cyp2a12 UTSW 7 27036646 makesense probably null
R2120:Cyp2a12 UTSW 7 27036646 makesense probably null
R2121:Cyp2a12 UTSW 7 27036646 makesense probably null
R2122:Cyp2a12 UTSW 7 27036646 makesense probably null
R2124:Cyp2a12 UTSW 7 27036646 makesense probably null
R2144:Cyp2a12 UTSW 7 27034769 missense possibly damaging 0.95
R2153:Cyp2a12 UTSW 7 27032617 missense probably benign 0.01
R2171:Cyp2a12 UTSW 7 27029632 missense probably damaging 1.00
R2182:Cyp2a12 UTSW 7 27031146 missense probably damaging 1.00
R2297:Cyp2a12 UTSW 7 27034632 missense possibly damaging 0.92
R4392:Cyp2a12 UTSW 7 27029275 missense probably damaging 0.98
R4900:Cyp2a12 UTSW 7 27031215 nonsense probably null
R4960:Cyp2a12 UTSW 7 27034150 missense probably benign 0.11
R5111:Cyp2a12 UTSW 7 27036621 missense possibly damaging 0.89
R5223:Cyp2a12 UTSW 7 27036463 critical splice acceptor site probably null
R5268:Cyp2a12 UTSW 7 27031218 missense probably benign 0.00
R5493:Cyp2a12 UTSW 7 27029125 missense unknown
R5524:Cyp2a12 UTSW 7 27031231 missense probably benign 0.00
R5806:Cyp2a12 UTSW 7 27029079 splice site probably null
R6320:Cyp2a12 UTSW 7 27031152 missense possibly damaging 0.75
R6823:Cyp2a12 UTSW 7 27034156 missense possibly damaging 0.77
R7958:Cyp2a12 UTSW 7 27029252 missense probably benign 0.13
R8093:Cyp2a12 UTSW 7 27036629 missense probably damaging 0.96
R8191:Cyp2a12 UTSW 7 27031104 missense probably benign 0.00
R8259:Cyp2a12 UTSW 7 27032658 nonsense probably null
RF021:Cyp2a12 UTSW 7 27035360 missense possibly damaging 0.73
Z1088:Cyp2a12 UTSW 7 27035420 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- AAGGCATCAGTGAGAGCTGC -3'
(R):5'- TGTTACTGCTGCTCACTGTG -3'

Sequencing Primer
(F):5'- AGTGAGAGCTGCCCCCAC -3'
(R):5'- GTTACTGCTGCTCACTGTGTGTTTC -3'
Posted On2016-06-21