Incidental Mutation 'R5143:Chrna7'
ID 396523
Institutional Source Beutler Lab
Gene Symbol Chrna7
Ensembl Gene ENSMUSG00000030525
Gene Name cholinergic receptor, nicotinic, alpha polypeptide 7
Synonyms alpha7 nicotinic receptor, alpha7, alpha7-nAChR, Acra7
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5143 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 62748440-62862274 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 62755895 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 217 (Y217C)
Ref Sequence ENSEMBL: ENSMUSP00000032738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032738]
AlphaFold P49582
Predicted Effect probably damaging
Transcript: ENSMUST00000032738
AA Change: Y217C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032738
Gene: ENSMUSG00000030525
AA Change: Y217C

DomainStartEndE-ValueType
low complexity region 10 17 N/A INTRINSIC
Pfam:Neur_chan_LBD 26 230 1e-75 PFAM
Pfam:Neur_chan_memb 237 487 3.6e-63 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are thought to be hetero-pentamers composed of homologous subunits. The proposed structure for each subunit is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. The protein encoded by this gene forms a homo-oligomeric channel, displays marked permeability to calcium ions and is a major component of brain nicotinic receptors that are blocked by, and highly sensitive to, alpha-bungarotoxin. Once this receptor binds acetylcholine, it undergoes an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. This gene is located in a region identified as a major susceptibility locus for juvenile myoclonic epilepsy and a chromosomal location involved in the genetic transmission of schizophrenia. An evolutionarily recent partial duplication event in this region results in a hybrid containing sequence from this gene and a novel FAM7A gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
PHENOTYPE: Nullizygous mice lack hippocampal fast nicotinic currents but show nicotine-induced seizures as well as altered anxiety behavior, fertility defects, airway basal cell hyperplasia. and higher TNF sythesis when endotoxemic. Newborns homozygous for a knock-in allele die with increased neuron apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,887,064 (GRCm39) probably null Het
Abcc2 T C 19: 43,810,100 (GRCm39) I886T probably benign Het
Adrb2 T C 18: 62,311,847 (GRCm39) Y326C probably damaging Het
Aplp1 G A 7: 30,140,548 (GRCm39) R334C probably damaging Het
AY358078 T C 14: 52,040,006 (GRCm39) S39P unknown Het
Bpifb2 A T 2: 153,720,424 (GRCm39) D61V probably damaging Het
Caap1 A T 4: 94,389,619 (GRCm39) N238K probably damaging Het
Cfap54 A G 10: 92,865,020 (GRCm39) V726A possibly damaging Het
Crocc T A 4: 140,768,350 (GRCm39) T414S probably benign Het
Cyp2a12 A G 7: 26,736,036 (GRCm39) I482V probably benign Het
Dnah6 A T 6: 73,158,744 (GRCm39) F620I possibly damaging Het
Eogt A G 6: 97,102,545 (GRCm39) L256P probably damaging Het
F5 A G 1: 164,039,397 (GRCm39) I2002M probably damaging Het
Foxp1 A G 6: 98,922,493 (GRCm39) probably null Het
Fut8 A G 12: 77,411,983 (GRCm39) D111G probably benign Het
Golgb1 C T 16: 36,719,051 (GRCm39) A319V probably benign Het
Hoxd3 C T 2: 74,576,716 (GRCm39) R39C probably damaging Het
Mfng C T 15: 78,648,588 (GRCm39) R163H probably benign Het
Or52b1 T A 7: 104,978,731 (GRCm39) I223F probably damaging Het
Pate8 T A 9: 36,493,200 (GRCm39) N41Y probably benign Het
Pcdhb2 A G 18: 37,429,785 (GRCm39) Y586C probably damaging Het
Plcd1 G A 9: 118,903,519 (GRCm39) Q442* probably null Het
Plppr5 A G 3: 117,419,552 (GRCm39) T207A probably benign Het
Pomt1 C A 2: 32,144,341 (GRCm39) A709E probably benign Het
Prmt8 A G 6: 127,709,677 (GRCm39) M61T probably benign Het
Ptpn23 A G 9: 110,214,506 (GRCm39) probably benign Het
Sbf2 T A 7: 110,021,747 (GRCm39) K493* probably null Het
Semp2l2a A G 8: 13,886,844 (GRCm39) S416P possibly damaging Het
Tmc2 A T 2: 130,076,738 (GRCm39) S355C probably damaging Het
Tonsl A G 15: 76,520,857 (GRCm39) S399P possibly damaging Het
Ttc14 T C 3: 33,863,050 (GRCm39) probably benign Het
Ttn A G 2: 76,568,409 (GRCm39) S19168P probably damaging Het
Usp17lb A T 7: 104,490,685 (GRCm39) S80T probably damaging Het
Vmn2r96 A G 17: 18,804,120 (GRCm39) I457V possibly damaging Het
Wdr64 G T 1: 175,553,979 (GRCm39) D170Y probably damaging Het
Zbtb42 T C 12: 112,645,948 (GRCm39) V41A probably damaging Het
Other mutations in Chrna7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01776:Chrna7 APN 7 62,749,267 (GRCm39) missense probably benign 0.01
IGL01999:Chrna7 APN 7 62,753,539 (GRCm39) missense probably damaging 1.00
IGL02016:Chrna7 APN 7 62,753,583 (GRCm39) missense probably damaging 1.00
IGL02388:Chrna7 APN 7 62,757,439 (GRCm39) missense probably damaging 1.00
IGL02400:Chrna7 APN 7 62,749,070 (GRCm39) missense probably damaging 1.00
IGL02458:Chrna7 APN 7 62,755,842 (GRCm39) missense probably damaging 1.00
IGL03039:Chrna7 APN 7 62,798,340 (GRCm39) missense probably damaging 1.00
inflation UTSW 7 62,798,349 (GRCm39) missense probably damaging 1.00
thaler UTSW 7 62,755,775 (GRCm39) missense probably damaging 1.00
R0034:Chrna7 UTSW 7 62,798,354 (GRCm39) missense possibly damaging 0.79
R0631:Chrna7 UTSW 7 62,749,391 (GRCm39) missense probably benign 0.00
R1666:Chrna7 UTSW 7 62,861,890 (GRCm39) missense possibly damaging 0.70
R1703:Chrna7 UTSW 7 62,749,255 (GRCm39) missense probably damaging 0.99
R1763:Chrna7 UTSW 7 62,749,000 (GRCm39) missense probably benign 0.05
R1974:Chrna7 UTSW 7 62,749,034 (GRCm39) missense probably damaging 1.00
R2294:Chrna7 UTSW 7 62,760,172 (GRCm39) missense probably benign 0.11
R2393:Chrna7 UTSW 7 62,748,994 (GRCm39) missense probably damaging 1.00
R4598:Chrna7 UTSW 7 62,753,538 (GRCm39) missense probably damaging 1.00
R4599:Chrna7 UTSW 7 62,753,538 (GRCm39) missense probably damaging 1.00
R4842:Chrna7 UTSW 7 62,862,196 (GRCm39) missense probably benign 0.05
R5310:Chrna7 UTSW 7 62,755,805 (GRCm39) missense probably damaging 1.00
R5339:Chrna7 UTSW 7 62,749,055 (GRCm39) missense probably damaging 1.00
R5516:Chrna7 UTSW 7 62,749,046 (GRCm39) missense probably damaging 0.98
R5807:Chrna7 UTSW 7 62,798,349 (GRCm39) missense probably damaging 1.00
R6501:Chrna7 UTSW 7 62,755,863 (GRCm39) missense probably damaging 1.00
R6918:Chrna7 UTSW 7 62,809,299 (GRCm39) missense probably benign 0.03
R7000:Chrna7 UTSW 7 62,755,787 (GRCm39) missense probably damaging 1.00
R7189:Chrna7 UTSW 7 62,755,775 (GRCm39) missense probably damaging 1.00
R7483:Chrna7 UTSW 7 62,754,738 (GRCm39) missense probably damaging 1.00
R7953:Chrna7 UTSW 7 62,753,541 (GRCm39) missense possibly damaging 0.82
R7955:Chrna7 UTSW 7 62,753,541 (GRCm39) missense possibly damaging 0.82
R7956:Chrna7 UTSW 7 62,753,541 (GRCm39) missense possibly damaging 0.82
R8235:Chrna7 UTSW 7 62,861,972 (GRCm39) missense probably damaging 1.00
R9125:Chrna7 UTSW 7 62,757,357 (GRCm39) nonsense probably null
R9356:Chrna7 UTSW 7 62,757,437 (GRCm39) missense probably damaging 1.00
R9694:Chrna7 UTSW 7 62,754,809 (GRCm39) missense probably damaging 1.00
Z1176:Chrna7 UTSW 7 62,861,932 (GRCm39) missense probably damaging 1.00
Z1177:Chrna7 UTSW 7 62,757,299 (GRCm39) critical splice donor site probably null
Z1191:Chrna7 UTSW 7 62,755,941 (GRCm39) missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CTGTAGAGCTAGCTTCAGAGGTG -3'
(R):5'- GGTTTGTCCAAATACCCATTACCC -3'

Sequencing Primer
(F):5'- CTAGCTTCAGAGGTGGTGGAG -3'
(R):5'- CCCATTTTTTAGGGCTGTG -3'
Posted On 2016-06-21