Incidental Mutation 'R5143:Chrna7'
ID396523
Institutional Source Beutler Lab
Gene Symbol Chrna7
Ensembl Gene ENSMUSG00000030525
Gene Namecholinergic receptor, nicotinic, alpha polypeptide 7
Synonymsalpha7-nAChR, alpha7, Acra7, alpha7 nicotinic receptor
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5143 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location63098692-63212569 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63106147 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 217 (Y217C)
Ref Sequence ENSEMBL: ENSMUSP00000032738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032738]
Predicted Effect probably damaging
Transcript: ENSMUST00000032738
AA Change: Y217C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032738
Gene: ENSMUSG00000030525
AA Change: Y217C

DomainStartEndE-ValueType
low complexity region 10 17 N/A INTRINSIC
Pfam:Neur_chan_LBD 26 230 1e-75 PFAM
Pfam:Neur_chan_memb 237 487 3.6e-63 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are thought to be hetero-pentamers composed of homologous subunits. The proposed structure for each subunit is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. The protein encoded by this gene forms a homo-oligomeric channel, displays marked permeability to calcium ions and is a major component of brain nicotinic receptors that are blocked by, and highly sensitive to, alpha-bungarotoxin. Once this receptor binds acetylcholine, it undergoes an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. This gene is located in a region identified as a major susceptibility locus for juvenile myoclonic epilepsy and a chromosomal location involved in the genetic transmission of schizophrenia. An evolutionarily recent partial duplication event in this region results in a hybrid containing sequence from this gene and a novel FAM7A gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
PHENOTYPE: Nullizygous mice lack hippocampal fast nicotinic currents but show nicotine-induced seizures as well as altered anxiety behavior, fertility defects, airway basal cell hyperplasia. and higher TNF sythesis when endotoxemic. Newborns homozygous for a knock-in allele die with increased neuron apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,739,198 probably null Het
Abcc2 T C 19: 43,821,661 I886T probably benign Het
Adrb2 T C 18: 62,178,776 Y326C probably damaging Het
AF366264 A G 8: 13,836,844 S416P possibly damaging Het
Aplp1 G A 7: 30,441,123 R334C probably damaging Het
AY358078 T C 14: 51,802,549 S39P unknown Het
Bpifb2 A T 2: 153,878,504 D61V probably damaging Het
Caap1 A T 4: 94,501,382 N238K probably damaging Het
Cfap54 A G 10: 93,029,158 V726A possibly damaging Het
Crocc T A 4: 141,041,039 T414S probably benign Het
Cyp2a12 A G 7: 27,036,611 I482V probably benign Het
Dnah6 A T 6: 73,181,761 F620I possibly damaging Het
Eogt A G 6: 97,125,584 L256P probably damaging Het
F5 A G 1: 164,211,828 I2002M probably damaging Het
Foxp1 A G 6: 98,945,532 probably null Het
Fut8 A G 12: 77,365,209 D111G probably benign Het
Gm17689 T A 9: 36,581,904 N41Y probably benign Het
Golgb1 C T 16: 36,898,689 A319V probably benign Het
Hoxd3 C T 2: 74,746,372 R39C probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Olfr690 T A 7: 105,329,524 I223F probably damaging Het
Pcdhb2 A G 18: 37,296,732 Y586C probably damaging Het
Plcd1 G A 9: 119,074,451 Q442* probably null Het
Plppr5 A G 3: 117,625,903 T207A probably benign Het
Pomt1 C A 2: 32,254,329 A709E probably benign Het
Prmt8 A G 6: 127,732,714 M61T probably benign Het
Ptpn23 A G 9: 110,385,438 probably benign Het
Sbf2 T A 7: 110,422,540 K493* probably null Het
Tmc2 A T 2: 130,234,818 S355C probably damaging Het
Tonsl A G 15: 76,636,657 S399P possibly damaging Het
Ttc14 T C 3: 33,808,901 probably benign Het
Ttn A G 2: 76,738,065 S19168P probably damaging Het
Usp17lb A T 7: 104,841,478 S80T probably damaging Het
Vmn2r96 A G 17: 18,583,858 I457V possibly damaging Het
Wdr64 G T 1: 175,726,413 D170Y probably damaging Het
Zbtb42 T C 12: 112,679,514 V41A probably damaging Het
Other mutations in Chrna7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01776:Chrna7 APN 7 63099519 missense probably benign 0.01
IGL01999:Chrna7 APN 7 63103791 missense probably damaging 1.00
IGL02016:Chrna7 APN 7 63103835 missense probably damaging 1.00
IGL02388:Chrna7 APN 7 63107691 missense probably damaging 1.00
IGL02400:Chrna7 APN 7 63099322 missense probably damaging 1.00
IGL02458:Chrna7 APN 7 63106094 missense probably damaging 1.00
IGL03039:Chrna7 APN 7 63148592 missense probably damaging 1.00
inflation UTSW 7 63148601 missense probably damaging 1.00
thaler UTSW 7 63106027 missense probably damaging 1.00
R0034:Chrna7 UTSW 7 63148606 missense possibly damaging 0.79
R0631:Chrna7 UTSW 7 63099643 missense probably benign 0.00
R1666:Chrna7 UTSW 7 63212142 missense possibly damaging 0.70
R1703:Chrna7 UTSW 7 63099507 missense probably damaging 0.99
R1763:Chrna7 UTSW 7 63099252 missense probably benign 0.05
R1974:Chrna7 UTSW 7 63099286 missense probably damaging 1.00
R2294:Chrna7 UTSW 7 63110424 missense probably benign 0.11
R2393:Chrna7 UTSW 7 63099246 missense probably damaging 1.00
R4598:Chrna7 UTSW 7 63103790 missense probably damaging 1.00
R4599:Chrna7 UTSW 7 63103790 missense probably damaging 1.00
R4842:Chrna7 UTSW 7 63212448 missense probably benign 0.05
R5310:Chrna7 UTSW 7 63106057 missense probably damaging 1.00
R5339:Chrna7 UTSW 7 63099307 missense probably damaging 1.00
R5516:Chrna7 UTSW 7 63099298 missense probably damaging 0.98
R5807:Chrna7 UTSW 7 63148601 missense probably damaging 1.00
R6501:Chrna7 UTSW 7 63106115 missense probably damaging 1.00
R6918:Chrna7 UTSW 7 63159551 missense probably benign 0.03
R7000:Chrna7 UTSW 7 63106039 missense probably damaging 1.00
R7189:Chrna7 UTSW 7 63106027 missense probably damaging 1.00
R7483:Chrna7 UTSW 7 63104990 missense probably damaging 1.00
R7953:Chrna7 UTSW 7 63103793 missense possibly damaging 0.82
R7955:Chrna7 UTSW 7 63103793 missense possibly damaging 0.82
R7956:Chrna7 UTSW 7 63103793 missense possibly damaging 0.82
R8235:Chrna7 UTSW 7 63212224 missense probably damaging 1.00
Z1176:Chrna7 UTSW 7 63212184 missense probably damaging 1.00
Z1177:Chrna7 UTSW 7 63107551 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGTAGAGCTAGCTTCAGAGGTG -3'
(R):5'- GGTTTGTCCAAATACCCATTACCC -3'

Sequencing Primer
(F):5'- CTAGCTTCAGAGGTGGTGGAG -3'
(R):5'- CCCATTTTTTAGGGCTGTG -3'
Posted On2016-06-21