Incidental Mutation 'R5143:Olfr690'
ID396525
Institutional Source Beutler Lab
Gene Symbol Olfr690
Ensembl Gene ENSMUSG00000050266
Gene Nameolfactory receptor 690
SynonymsGA_x6K02T2PBJ9-7959171-7958224, MOR31-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5143 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105328225-105334104 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105329524 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 223 (I223F)
Ref Sequence ENSEMBL: ENSMUSP00000150831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061920] [ENSMUST00000211006] [ENSMUST00000216230]
Predicted Effect probably damaging
Transcript: ENSMUST00000061920
AA Change: I223F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061272
Gene: ENSMUSG00000050266
AA Change: I223F

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
Pfam:7tm_4 33 312 2e-110 PFAM
Pfam:7TM_GPCR_Srsx 37 264 1.4e-9 PFAM
Pfam:7tm_1 43 294 1.7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209868
Predicted Effect probably damaging
Transcript: ENSMUST00000211006
AA Change: I223F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216230
AA Change: I223F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,739,198 probably null Het
Abcc2 T C 19: 43,821,661 I886T probably benign Het
Adrb2 T C 18: 62,178,776 Y326C probably damaging Het
AF366264 A G 8: 13,836,844 S416P possibly damaging Het
Aplp1 G A 7: 30,441,123 R334C probably damaging Het
AY358078 T C 14: 51,802,549 S39P unknown Het
Bpifb2 A T 2: 153,878,504 D61V probably damaging Het
Caap1 A T 4: 94,501,382 N238K probably damaging Het
Cfap54 A G 10: 93,029,158 V726A possibly damaging Het
Chrna7 T C 7: 63,106,147 Y217C probably damaging Het
Crocc T A 4: 141,041,039 T414S probably benign Het
Cyp2a12 A G 7: 27,036,611 I482V probably benign Het
Dnah6 A T 6: 73,181,761 F620I possibly damaging Het
Eogt A G 6: 97,125,584 L256P probably damaging Het
F5 A G 1: 164,211,828 I2002M probably damaging Het
Foxp1 A G 6: 98,945,532 probably null Het
Fut8 A G 12: 77,365,209 D111G probably benign Het
Gm17689 T A 9: 36,581,904 N41Y probably benign Het
Golgb1 C T 16: 36,898,689 A319V probably benign Het
Hoxd3 C T 2: 74,746,372 R39C probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Pcdhb2 A G 18: 37,296,732 Y586C probably damaging Het
Plcd1 G A 9: 119,074,451 Q442* probably null Het
Plppr5 A G 3: 117,625,903 T207A probably benign Het
Pomt1 C A 2: 32,254,329 A709E probably benign Het
Prmt8 A G 6: 127,732,714 M61T probably benign Het
Ptpn23 A G 9: 110,385,438 probably benign Het
Sbf2 T A 7: 110,422,540 K493* probably null Het
Tmc2 A T 2: 130,234,818 S355C probably damaging Het
Tonsl A G 15: 76,636,657 S399P possibly damaging Het
Ttc14 T C 3: 33,808,901 probably benign Het
Ttn A G 2: 76,738,065 S19168P probably damaging Het
Usp17lb A T 7: 104,841,478 S80T probably damaging Het
Vmn2r96 A G 17: 18,583,858 I457V possibly damaging Het
Wdr64 G T 1: 175,726,413 D170Y probably damaging Het
Zbtb42 T C 12: 112,679,514 V41A probably damaging Het
Other mutations in Olfr690
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Olfr690 APN 7 105329382 missense possibly damaging 0.95
IGL01403:Olfr690 APN 7 105329398 missense probably benign 0.01
IGL01546:Olfr690 APN 7 105329692 missense probably damaging 1.00
IGL02936:Olfr690 APN 7 105330005 nonsense probably null
R0206:Olfr690 UTSW 7 105329883 missense possibly damaging 0.76
R0206:Olfr690 UTSW 7 105329883 missense possibly damaging 0.76
R1425:Olfr690 UTSW 7 105329715 missense probably damaging 1.00
R1911:Olfr690 UTSW 7 105329383 missense probably benign 0.11
R2126:Olfr690 UTSW 7 105329252 nonsense probably null
R2511:Olfr690 UTSW 7 105329610 missense probably damaging 1.00
R2919:Olfr690 UTSW 7 105329860 missense probably damaging 1.00
R3755:Olfr690 UTSW 7 105330151 missense probably damaging 1.00
R4152:Olfr690 UTSW 7 105329385 missense probably damaging 1.00
R4153:Olfr690 UTSW 7 105329385 missense probably damaging 1.00
R4154:Olfr690 UTSW 7 105329385 missense probably damaging 1.00
R4247:Olfr690 UTSW 7 105330148 missense probably benign
R5015:Olfr690 UTSW 7 105329604 missense possibly damaging 0.61
R5642:Olfr690 UTSW 7 105329565 missense probably damaging 1.00
R6747:Olfr690 UTSW 7 105330027 missense probably benign 0.00
R6961:Olfr690 UTSW 7 105329706 missense probably damaging 1.00
R7074:Olfr690 UTSW 7 105329268 missense probably benign 0.44
R8066:Olfr690 UTSW 7 105329554 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CCAGAAGAATGTGCACATGG -3'
(R):5'- AAAATGACCCTGGCCATCTG -3'

Sequencing Primer
(F):5'- AATGTGCACATGGTGGGG -3'
(R):5'- CCTATCATATTTCTGCTGAAGAGGC -3'
Posted On2016-06-21